Incidental Mutation 'R5285:Vmn2r120'
ID403021
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Namevomeronasal 2, receptor 120
SynonymsEG224916
MMRRC Submission 042869-MU
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5285 (G1)
Quality Score173
Status Validated
Chromosome17
Chromosomal Location57508783-57545314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57536703 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 47 (L47P)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
Predicted Effect probably damaging
Transcript: ENSMUST00000165781
AA Change: L47P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: L47P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,708,465 T12A probably benign Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adcy8 G T 15: 64,767,857 H685N possibly damaging Het
Aldh1l1 A T 6: 90,576,770 K539* probably null Het
Ap1m2 G T 9: 21,305,637 Y134* probably null Het
Apobr A G 7: 126,585,003 probably benign Het
Atl1 A G 12: 69,954,499 K345R probably benign Het
Avil T C 10: 127,018,459 L765P probably damaging Het
Caps2 T A 10: 112,208,311 Y472N probably benign Het
Cd177 A T 7: 24,746,249 S590T probably benign Het
Cep295 T C 9: 15,322,591 D2223G probably benign Het
Cfh T C 1: 140,100,898 T493A probably benign Het
Chek1 T C 9: 36,714,452 D299G probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Crhr1 A T 11: 104,170,497 I243F possibly damaging Het
Cyp3a11 A G 5: 145,855,083 V500A probably benign Het
Dcdc5 A T 2: 106,368,155 noncoding transcript Het
Ergic3 A G 2: 156,018,037 probably benign Het
Fabp3-ps1 T G 10: 86,732,202 probably benign Het
Gm16432 A G 1: 178,103,888 K458E unknown Het
Gm6445 C A 19: 9,607,668 noncoding transcript Het
Gucy2d C A 7: 98,458,267 probably null Het
Ighv1-19-1 C A 12: 114,704,252 probably benign Het
Igkv2-116 G T 6: 68,152,479 R75L probably benign Het
Inhbc C A 10: 127,357,400 R249L probably damaging Het
Lrrn2 T A 1: 132,939,245 S683T possibly damaging Het
Lyst T C 13: 13,634,426 V227A probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Msh4 T C 3: 153,873,713 N587S probably benign Het
Mug1 G A 6: 121,841,107 E126K probably benign Het
Nav2 T C 7: 49,548,234 S1204P probably damaging Het
Ncor1 A G 11: 62,392,649 I413T probably damaging Het
Nipa2 A T 7: 55,933,012 Y328* probably null Het
Olfr178 A T 16: 58,890,108 Y37* probably null Het
Olfr195 T C 16: 59,149,270 L140P probably damaging Het
Olfr384 T A 11: 73,602,941 Y120* probably null Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr645 A G 7: 104,084,133 *316R probably null Het
Pla2g4e T C 2: 120,189,504 D155G probably damaging Het
Plxnb1 C T 9: 109,108,459 T1176I probably damaging Het
Polg A G 7: 79,465,225 probably benign Het
Prl8a2 G A 13: 27,350,133 probably null Het
Prmt7 G A 8: 106,248,359 R529Q probably benign Het
Psg17 T A 7: 18,820,201 L41F probably benign Het
Rad18 T C 6: 112,686,765 R73G probably benign Het
Rhpn2 G T 7: 35,381,565 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sarm1 A G 11: 78,497,439 F7S probably benign Het
Sgip1 T A 4: 102,921,477 probably benign Het
Sh3gl2 A G 4: 85,376,449 K99R probably benign Het
Sorbs1 G A 19: 40,321,890 T1018I probably damaging Het
Spns2 G A 11: 72,489,479 A106V possibly damaging Het
Stab1 A G 14: 31,143,476 probably benign Het
Steap3 T C 1: 120,241,880 D191G probably damaging Het
Stxbp5 T C 10: 9,798,275 probably null Het
Sycp2 A T 2: 178,392,398 probably null Het
Tm6sf1 A G 7: 81,859,452 S2G possibly damaging Het
Usp24 T A 4: 106,407,033 D1720E probably benign Het
Vmn1r200 G A 13: 22,395,287 E78K possibly damaging Het
Vmn2r14 T C 5: 109,217,576 N544S probably damaging Het
Vwa1 C T 4: 155,770,895 A254T probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Zfp940 A T 7: 29,845,600 L294H probably damaging Het
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R0517:Vmn2r120 UTSW 17 57508949 missense probably damaging 1.00
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1922:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4348:Vmn2r120 UTSW 17 57522466 missense possibly damaging 0.47
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6248:Vmn2r120 UTSW 17 57545287 missense probably benign 0.03
R6256:Vmn2r120 UTSW 17 57524700 nonsense probably null
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
R7653:Vmn2r120 UTSW 17 57509258 missense possibly damaging 0.93
R7667:Vmn2r120 UTSW 17 57536657 missense probably benign 0.04
R7775:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7778:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7797:Vmn2r120 UTSW 17 57508874 missense probably damaging 1.00
R7824:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7902:Vmn2r120 UTSW 17 57509244 missense possibly damaging 0.87
R7922:Vmn2r120 UTSW 17 57524683 missense probably damaging 0.99
R8508:Vmn2r120 UTSW 17 57525843 missense probably benign 0.03
R8847:Vmn2r120 UTSW 17 57509217 missense probably benign 0.01
R8882:Vmn2r120 UTSW 17 57545229 missense probably benign 0.01
RF005:Vmn2r120 UTSW 17 57521991 missense possibly damaging 0.65
Z1177:Vmn2r120 UTSW 17 57509245 missense probably benign 0.00
Z1188:Vmn2r120 UTSW 17 57522436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAACACATGGTGCTGGTT -3'
(R):5'- GCATCTGCTGTCACCTGAG -3'

Sequencing Primer
(F):5'- GTCGATGTGGATCAAAAGCCTCC -3'
(R):5'- AGGTGCTTCTAGACTCTCCATG -3'
Posted On2016-07-22