Incidental Mutation 'R5209:Arhgef5'
ID 403034
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
MMRRC Submission 042784-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5209 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43273700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 462 (I462F)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably benign
Transcript: ENSMUST00000031750
AA Change: I462F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: I462F

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,818 T4453A possibly damaging Het
Abca14 T C 7: 120,232,907 V500A probably benign Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Adgb C A 10: 10,398,937 V759L possibly damaging Het
Adprhl1 T A 8: 13,242,563 K243* probably null Het
Arhgap24 T A 5: 102,892,149 D317E probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Btbd18 A G 2: 84,668,099 T694A possibly damaging Het
Ces1d A T 8: 93,175,188 probably benign Het
Chmp2a C A 7: 13,032,674 V106F probably damaging Het
Cinp T C 12: 110,874,060 E219G probably benign Het
Col5a3 C T 9: 20,778,643 probably benign Het
Dnhd1 T G 7: 105,696,460 S2271A probably benign Het
Epg5 T A 18: 77,951,282 L376H probably damaging Het
Fam81a T C 9: 70,125,160 T17A probably benign Het
Fgd2 T A 17: 29,368,376 probably null Het
Gjc3 C T 5: 137,957,271 V251I probably benign Het
Gnaz T G 10: 74,991,991 F192V probably benign Het
Hmgcr T C 13: 96,666,512 probably benign Het
Mamdc4 G T 2: 25,566,923 A614E probably damaging Het
Mapk8ip2 A T 15: 89,459,287 Q713L probably damaging Het
Mettl1 T C 10: 127,045,334 V238A possibly damaging Het
Ms4a4c G A 19: 11,416,438 G74E probably damaging Het
Msh3 A G 13: 92,344,954 probably null Het
Mtmr14 T A 6: 113,253,775 Y113* probably null Het
Mylk T C 16: 34,922,625 L1169P possibly damaging Het
Npr3 A G 15: 11,848,603 V426A possibly damaging Het
Olfr105-ps T C 17: 37,382,830 S88P probably damaging Het
Olfr221 T C 14: 52,035,953 T53A probably benign Het
Olfr771 A C 10: 129,160,932 D17E possibly damaging Het
Olfr905 T A 9: 38,473,521 M258K possibly damaging Het
Pcdhb17 T C 18: 37,487,461 F768S probably damaging Het
Piezo2 T C 18: 63,032,929 N2077S probably damaging Het
Pkd1l2 G A 8: 117,056,442 P713L probably benign Het
Primpol T C 8: 46,590,260 T333A probably benign Het
Pth2r A T 1: 65,388,697 T510S probably benign Het
Ptprr A T 10: 116,162,609 E208V probably damaging Het
Rag1 T C 2: 101,644,215 Y194C probably benign Het
Reep5 A T 18: 34,357,240 probably null Het
Rexo5 T A 7: 119,834,299 Y493* probably null Het
Rgs9 T C 11: 109,239,594 probably null Het
Rps6ka1 A T 4: 133,865,818 V218D probably damaging Het
Satb1 A T 17: 51,809,207 M16K probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn14 A G 11: 83,279,633 F395S possibly damaging Het
Sptbn5 T A 2: 120,072,002 I82F probably benign Het
Stam T A 2: 14,146,347 I505K probably benign Het
Tesk2 G A 4: 116,724,698 probably benign Het
Trappc12 T C 12: 28,737,794 K430R probably benign Het
Trmo T C 4: 46,387,740 N34D probably damaging Het
Ubr2 C A 17: 46,968,424 C686F probably damaging Het
Vdac1 C T 11: 52,376,452 T60I probably damaging Het
Zfp652 G C 11: 95,763,665 R478P possibly damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43274802 missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTTCCAGTGGCTTCCGTAG -3'
(R):5'- ACAATGATGTGGAGTGTCAGCTG -3'

Sequencing Primer
(F):5'- CAGTGGCTTCCGTAGATCCTGAG -3'
(R):5'- TGGGGTCTCCTCAGGAAG -3'
Posted On 2016-07-22