Mutagenetix > Incidental Mutations

Incidental Mutation 'R5209:Adprhl1'

403040

Institutional Source

Beutler Lab

Gene Symbol

Adprhl1

Ensembl Gene

ENSMUSG00000031448

Gene Name

ADP-ribosylhydrolase like 1

Synonyms

Arh2, D330008N11Rik

MMRRC Submission

042784-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5209 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13221663-13254162 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 13242563 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 243 (K243*)

Ref Sequence

ENSEMBL: ENSMUSP00000145145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]

Predicted Effect

probably null
Transcript: ENSMUST00000033825
AA Change: K243*

SMART Domains

Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: K243*

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	1.2e-53	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166438

Predicted Effect

probably null
Transcript: ENSMUST00000168498
AA Change: K188*

SMART Domains

Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448
AA Change: K188*

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	69	196	9e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171619

SMART Domains

Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	1	135	4.9e-18	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000204916
AA Change: K243*

SMART Domains

Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: K243*

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	4.2e-49	PFAM
low complexity region	509	527	N/A	INTRINSIC
low complexity region	955	969	N/A	INTRINSIC
internal_repeat_1	1047	1150	1.82e-5	PROSPERO
internal_repeat_1	1157	1274	1.82e-5	PROSPERO
low complexity region	1275	1290	N/A	INTRINSIC

Meta Mutation Damage Score

0.9706

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,283,818	T4453A	possibly damaging	Het
Abca14	T	C	7: 120,232,907	V500A	probably benign	Het
Abcg4	A	G	9: 44,275,375	Y491H	probably damaging	Het
Adgb	C	A	10: 10,398,937	V759L	possibly damaging	Het
Arhgap24	T	A	5: 102,892,149	D317E	probably benign	Het
Arhgef5	A	T	6: 43,273,700	I462F	probably benign	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
Btbd18	A	G	2: 84,668,099	T694A	possibly damaging	Het
Ces1d	A	T	8: 93,175,188		probably benign	Het
Chmp2a	C	A	7: 13,032,674	V106F	probably damaging	Het
Cinp	T	C	12: 110,874,060	E219G	probably benign	Het
Col5a3	C	T	9: 20,778,643		probably benign	Het
Dnhd1	T	G	7: 105,696,460	S2271A	probably benign	Het
Epg5	T	A	18: 77,951,282	L376H	probably damaging	Het
Fam81a	T	C	9: 70,125,160	T17A	probably benign	Het
Fgd2	T	A	17: 29,368,376		probably null	Het
Gjc3	C	T	5: 137,957,271	V251I	probably benign	Het
Gnaz	T	G	10: 74,991,991	F192V	probably benign	Het
Hmgcr	T	C	13: 96,666,512		probably benign	Het
Mamdc4	G	T	2: 25,566,923	A614E	probably damaging	Het
Mapk8ip2	A	T	15: 89,459,287	Q713L	probably damaging	Het
Mettl1	T	C	10: 127,045,334	V238A	possibly damaging	Het
Ms4a4c	G	A	19: 11,416,438	G74E	probably damaging	Het
Msh3	A	G	13: 92,344,954		probably null	Het
Mtmr14	T	A	6: 113,253,775	Y113*	probably null	Het
Mylk	T	C	16: 34,922,625	L1169P	possibly damaging	Het
Npr3	A	G	15: 11,848,603	V426A	possibly damaging	Het
Olfr105-ps	T	C	17: 37,382,830	S88P	probably damaging	Het
Olfr221	T	C	14: 52,035,953	T53A	probably benign	Het
Olfr771	A	C	10: 129,160,932	D17E	possibly damaging	Het
Olfr905	T	A	9: 38,473,521	M258K	possibly damaging	Het
Pcdhb17	T	C	18: 37,487,461	F768S	probably damaging	Het
Piezo2	T	C	18: 63,032,929	N2077S	probably damaging	Het
Pkd1l2	G	A	8: 117,056,442	P713L	probably benign	Het
Primpol	T	C	8: 46,590,260	T333A	probably benign	Het
Pth2r	A	T	1: 65,388,697	T510S	probably benign	Het
Ptprr	A	T	10: 116,162,609	E208V	probably damaging	Het
Rag1	T	C	2: 101,644,215	Y194C	probably benign	Het
Reep5	A	T	18: 34,357,240		probably null	Het
Rexo5	T	A	7: 119,834,299	Y493*	probably null	Het
Rgs9	T	C	11: 109,239,594		probably null	Het
Rps6ka1	A	T	4: 133,865,818	V218D	probably damaging	Het
Satb1	A	T	17: 51,809,207	M16K	probably benign	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slfn14	A	G	11: 83,279,633	F395S	possibly damaging	Het
Sptbn5	T	A	2: 120,072,002	I82F	probably benign	Het
Stam	T	A	2: 14,146,347	I505K	probably benign	Het
Tesk2	G	A	4: 116,724,698		probably benign	Het
Trappc12	T	C	12: 28,737,794	K430R	probably benign	Het
Trmo	T	C	4: 46,387,740	N34D	probably damaging	Het
Ubr2	C	A	17: 46,968,424	C686F	probably damaging	Het
Vdac1	C	T	11: 52,376,452	T60I	probably damaging	Het
Zfp652	G	C	11: 95,763,665	R478P	possibly damaging	Het

Other mutations in Adprhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03268:Adprhl1	APN	8	13246170	splice site	probably benign
BB003:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB004:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB005:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB006:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB013:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB014:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB015:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB016:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R0244:Adprhl1	UTSW	8	13242391	splice site	probably benign
R0636:Adprhl1	UTSW	8	13248702	missense	probably damaging	1.00
R1295:Adprhl1	UTSW	8	13248624	missense	probably damaging	1.00
R2111:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2112:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2184:Adprhl1	UTSW	8	13242559	missense	probably benign	0.00
R4411:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4412:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4413:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4615:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R4618:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R5016:Adprhl1	UTSW	8	13224889	missense	possibly damaging	0.88
R5058:Adprhl1	UTSW	8	13242625	missense	probably damaging	1.00
R5060:Adprhl1	UTSW	8	13248621	missense	possibly damaging	0.63
R6103:Adprhl1	UTSW	8	13222055	missense	possibly damaging	0.91
R6158:Adprhl1	UTSW	8	13224977	missense	possibly damaging	0.93
R6221:Adprhl1	UTSW	8	13225634	missense	probably benign	0.01
R6971:Adprhl1	UTSW	8	13223476	missense	probably benign
R7087:Adprhl1	UTSW	8	13221856	missense	probably damaging	0.99
R7362:Adprhl1	UTSW	8	13245534	missense	probably damaging	1.00
R7404:Adprhl1	UTSW	8	13225118	missense	probably damaging	0.99
R7422:Adprhl1	UTSW	8	13222873	missense	probably benign	0.28
R7439:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7441:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7772:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7773:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7774:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7776:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7876:Adprhl1	UTSW	8	13223509	missense	probably benign	0.00
R7877:Adprhl1	UTSW	8	13225316	nonsense	probably null
R7926:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7927:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7928:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7929:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7944:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7945:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7946:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7947:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7949:Adprhl1	UTSW	8	13224225	missense	possibly damaging	0.93
R8155:Adprhl1	UTSW	8	13221764	missense	probably damaging	0.99
R8182:Adprhl1	UTSW	8	13222774	missense	probably benign	0.07
R8753:Adprhl1	UTSW	8	13222118	missense	not run
Z1176:Adprhl1	UTSW	8	13225613	missense	probably benign	0.01
Z1177:Adprhl1	UTSW	8	13245476	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AGCTCCACTTCTTGTAGGTCTG -3'
(R):5'- CCATTGGAGCTGCCTACTTTTG -3'

Sequencing Primer
(F):5'- CTTCTTGTAGGTCTGAAGAGAACCAC -3'
(R):5'- CTACTTTTGGCACAGATACGC -3'

Posted On

2016-07-22