Incidental Mutation 'R5209:Adprhl1'
ID403040
Institutional Source Beutler Lab
Gene Symbol Adprhl1
Ensembl Gene ENSMUSG00000031448
Gene NameADP-ribosylhydrolase like 1
SynonymsArh2, D330008N11Rik
MMRRC Submission 042784-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5209 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13221663-13254162 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13242563 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 243 (K243*)
Ref Sequence ENSEMBL: ENSMUSP00000145145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]
Predicted Effect probably null
Transcript: ENSMUST00000033825
AA Change: K243*
SMART Domains Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: K243*

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 1.2e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166438
Predicted Effect probably null
Transcript: ENSMUST00000168498
AA Change: K188*
SMART Domains Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448
AA Change: K188*

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 69 196 9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171619
SMART Domains Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 1 135 4.9e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204916
AA Change: K243*
SMART Domains Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: K243*

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 4.2e-49 PFAM
low complexity region 509 527 N/A INTRINSIC
low complexity region 955 969 N/A INTRINSIC
internal_repeat_1 1047 1150 1.82e-5 PROSPERO
internal_repeat_1 1157 1274 1.82e-5 PROSPERO
low complexity region 1275 1290 N/A INTRINSIC
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,818 T4453A possibly damaging Het
Abca14 T C 7: 120,232,907 V500A probably benign Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Adgb C A 10: 10,398,937 V759L possibly damaging Het
Arhgap24 T A 5: 102,892,149 D317E probably benign Het
Arhgef5 A T 6: 43,273,700 I462F probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Btbd18 A G 2: 84,668,099 T694A possibly damaging Het
Ces1d A T 8: 93,175,188 probably benign Het
Chmp2a C A 7: 13,032,674 V106F probably damaging Het
Cinp T C 12: 110,874,060 E219G probably benign Het
Col5a3 C T 9: 20,778,643 probably benign Het
Dnhd1 T G 7: 105,696,460 S2271A probably benign Het
Epg5 T A 18: 77,951,282 L376H probably damaging Het
Fam81a T C 9: 70,125,160 T17A probably benign Het
Fgd2 T A 17: 29,368,376 probably null Het
Gjc3 C T 5: 137,957,271 V251I probably benign Het
Gnaz T G 10: 74,991,991 F192V probably benign Het
Hmgcr T C 13: 96,666,512 probably benign Het
Mamdc4 G T 2: 25,566,923 A614E probably damaging Het
Mapk8ip2 A T 15: 89,459,287 Q713L probably damaging Het
Mettl1 T C 10: 127,045,334 V238A possibly damaging Het
Ms4a4c G A 19: 11,416,438 G74E probably damaging Het
Msh3 A G 13: 92,344,954 probably null Het
Mtmr14 T A 6: 113,253,775 Y113* probably null Het
Mylk T C 16: 34,922,625 L1169P possibly damaging Het
Npr3 A G 15: 11,848,603 V426A possibly damaging Het
Olfr105-ps T C 17: 37,382,830 S88P probably damaging Het
Olfr221 T C 14: 52,035,953 T53A probably benign Het
Olfr771 A C 10: 129,160,932 D17E possibly damaging Het
Olfr905 T A 9: 38,473,521 M258K possibly damaging Het
Pcdhb17 T C 18: 37,487,461 F768S probably damaging Het
Piezo2 T C 18: 63,032,929 N2077S probably damaging Het
Pkd1l2 G A 8: 117,056,442 P713L probably benign Het
Primpol T C 8: 46,590,260 T333A probably benign Het
Pth2r A T 1: 65,388,697 T510S probably benign Het
Ptprr A T 10: 116,162,609 E208V probably damaging Het
Rag1 T C 2: 101,644,215 Y194C probably benign Het
Reep5 A T 18: 34,357,240 probably null Het
Rexo5 T A 7: 119,834,299 Y493* probably null Het
Rgs9 T C 11: 109,239,594 probably null Het
Rps6ka1 A T 4: 133,865,818 V218D probably damaging Het
Satb1 A T 17: 51,809,207 M16K probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn14 A G 11: 83,279,633 F395S possibly damaging Het
Sptbn5 T A 2: 120,072,002 I82F probably benign Het
Stam T A 2: 14,146,347 I505K probably benign Het
Tesk2 G A 4: 116,724,698 probably benign Het
Trappc12 T C 12: 28,737,794 K430R probably benign Het
Trmo T C 4: 46,387,740 N34D probably damaging Het
Ubr2 C A 17: 46,968,424 C686F probably damaging Het
Vdac1 C T 11: 52,376,452 T60I probably damaging Het
Zfp652 G C 11: 95,763,665 R478P possibly damaging Het
Other mutations in Adprhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Adprhl1 APN 8 13246170 splice site probably benign
R0244:Adprhl1 UTSW 8 13242391 splice site probably benign
R0636:Adprhl1 UTSW 8 13248702 missense probably damaging 1.00
R1295:Adprhl1 UTSW 8 13248624 missense probably damaging 1.00
R2111:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2112:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2184:Adprhl1 UTSW 8 13242559 missense probably benign 0.00
R4411:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4412:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4413:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4615:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R4618:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R5016:Adprhl1 UTSW 8 13224889 missense possibly damaging 0.88
R5058:Adprhl1 UTSW 8 13242625 missense probably damaging 1.00
R5060:Adprhl1 UTSW 8 13248621 missense possibly damaging 0.63
R6103:Adprhl1 UTSW 8 13222055 missense possibly damaging 0.91
R6158:Adprhl1 UTSW 8 13224977 missense possibly damaging 0.93
R6221:Adprhl1 UTSW 8 13225634 missense probably benign 0.01
R6971:Adprhl1 UTSW 8 13223476 missense probably benign
R7087:Adprhl1 UTSW 8 13221856 missense probably damaging 0.99
R7362:Adprhl1 UTSW 8 13245534 missense probably damaging 1.00
R7404:Adprhl1 UTSW 8 13225118 missense probably damaging 0.99
R7422:Adprhl1 UTSW 8 13222873 missense probably benign 0.28
R7439:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7441:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7772:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7773:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7774:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7776:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7876:Adprhl1 UTSW 8 13223509 missense probably benign 0.00
R7877:Adprhl1 UTSW 8 13225316 nonsense probably null
R7959:Adprhl1 UTSW 8 13223509 missense probably benign 0.00
R7960:Adprhl1 UTSW 8 13225316 nonsense probably null
Z1176:Adprhl1 UTSW 8 13225613 missense probably benign 0.01
Z1177:Adprhl1 UTSW 8 13245476 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGCTCCACTTCTTGTAGGTCTG -3'
(R):5'- CCATTGGAGCTGCCTACTTTTG -3'

Sequencing Primer
(F):5'- CTTCTTGTAGGTCTGAAGAGAACCAC -3'
(R):5'- CTACTTTTGGCACAGATACGC -3'
Posted On2016-07-22