Incidental Mutation 'R5209:Olfr905'
ID403045
Institutional Source Beutler Lab
Gene Symbol Olfr905
Ensembl Gene ENSMUSG00000096794
Gene Nameolfactory receptor 905
SynonymsMOR167-1, GA_x6K02T2PVTD-32165709-32166641
MMRRC Submission 042784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5209 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38471107-38477013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38473521 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 258 (M258K)
Ref Sequence ENSEMBL: ENSMUSP00000150357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051111] [ENSMUST00000214377] [ENSMUST00000216724]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051111
AA Change: M258K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057998
Gene: ENSMUSG00000096794
AA Change: M258K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-50 PFAM
Pfam:7tm_1 41 298 4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214377
AA Change: M258K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216724
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,818 T4453A possibly damaging Het
Abca14 T C 7: 120,232,907 V500A probably benign Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Adgb C A 10: 10,398,937 V759L possibly damaging Het
Adprhl1 T A 8: 13,242,563 K243* probably null Het
Arhgap24 T A 5: 102,892,149 D317E probably benign Het
Arhgef5 A T 6: 43,273,700 I462F probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Btbd18 A G 2: 84,668,099 T694A possibly damaging Het
Ces1d A T 8: 93,175,188 probably benign Het
Chmp2a C A 7: 13,032,674 V106F probably damaging Het
Cinp T C 12: 110,874,060 E219G probably benign Het
Col5a3 C T 9: 20,778,643 probably benign Het
Dnhd1 T G 7: 105,696,460 S2271A probably benign Het
Epg5 T A 18: 77,951,282 L376H probably damaging Het
Fam81a T C 9: 70,125,160 T17A probably benign Het
Fgd2 T A 17: 29,368,376 probably null Het
Gjc3 C T 5: 137,957,271 V251I probably benign Het
Gnaz T G 10: 74,991,991 F192V probably benign Het
Hmgcr T C 13: 96,666,512 probably benign Het
Mamdc4 G T 2: 25,566,923 A614E probably damaging Het
Mapk8ip2 A T 15: 89,459,287 Q713L probably damaging Het
Mettl1 T C 10: 127,045,334 V238A possibly damaging Het
Ms4a4c G A 19: 11,416,438 G74E probably damaging Het
Msh3 A G 13: 92,344,954 probably null Het
Mtmr14 T A 6: 113,253,775 Y113* probably null Het
Mylk T C 16: 34,922,625 L1169P possibly damaging Het
Npr3 A G 15: 11,848,603 V426A possibly damaging Het
Olfr105-ps T C 17: 37,382,830 S88P probably damaging Het
Olfr221 T C 14: 52,035,953 T53A probably benign Het
Olfr771 A C 10: 129,160,932 D17E possibly damaging Het
Pcdhb17 T C 18: 37,487,461 F768S probably damaging Het
Piezo2 T C 18: 63,032,929 N2077S probably damaging Het
Pkd1l2 G A 8: 117,056,442 P713L probably benign Het
Primpol T C 8: 46,590,260 T333A probably benign Het
Pth2r A T 1: 65,388,697 T510S probably benign Het
Ptprr A T 10: 116,162,609 E208V probably damaging Het
Rag1 T C 2: 101,644,215 Y194C probably benign Het
Reep5 A T 18: 34,357,240 probably null Het
Rexo5 T A 7: 119,834,299 Y493* probably null Het
Rgs9 T C 11: 109,239,594 probably null Het
Rps6ka1 A T 4: 133,865,818 V218D probably damaging Het
Satb1 A T 17: 51,809,207 M16K probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn14 A G 11: 83,279,633 F395S possibly damaging Het
Sptbn5 T A 2: 120,072,002 I82F probably benign Het
Stam T A 2: 14,146,347 I505K probably benign Het
Tesk2 G A 4: 116,724,698 probably benign Het
Trappc12 T C 12: 28,737,794 K430R probably benign Het
Trmo T C 4: 46,387,740 N34D probably damaging Het
Ubr2 C A 17: 46,968,424 C686F probably damaging Het
Vdac1 C T 11: 52,376,452 T60I probably damaging Het
Zfp652 G C 11: 95,763,665 R478P possibly damaging Het
Other mutations in Olfr905
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr905 APN 9 38473042 missense possibly damaging 0.52
IGL03168:Olfr905 APN 9 38473019 missense probably benign
R0003:Olfr905 UTSW 9 38473316 missense probably benign 0.24
R0062:Olfr905 UTSW 9 38473258 missense probably benign 0.03
R0625:Olfr905 UTSW 9 38473208 missense possibly damaging 0.90
R0744:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R0836:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R2085:Olfr905 UTSW 9 38472927 missense probably damaging 1.00
R2898:Olfr905 UTSW 9 38472975 missense probably damaging 0.99
R4462:Olfr905 UTSW 9 38473064 missense probably benign 0.32
R4655:Olfr905 UTSW 9 38472824 missense probably damaging 0.99
R5759:Olfr905 UTSW 9 38473535 missense possibly damaging 0.73
R6453:Olfr905 UTSW 9 38473575 missense probably benign 0.18
R6501:Olfr905 UTSW 9 38473289 missense possibly damaging 0.88
R6934:Olfr905 UTSW 9 38473176 missense probably benign
R6999:Olfr905 UTSW 9 38473239 missense probably damaging 1.00
R7295:Olfr905 UTSW 9 38473443 missense probably benign 0.07
R7677:Olfr905 UTSW 9 38473535 missense possibly damaging 0.73
R7708:Olfr905 UTSW 9 38473385 missense probably damaging 1.00
R7843:Olfr905 UTSW 9 38472947 missense probably damaging 0.99
R7926:Olfr905 UTSW 9 38472947 missense probably damaging 0.99
X0053:Olfr905 UTSW 9 38473176 missense probably benign
X0065:Olfr905 UTSW 9 38473006 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCACCAGCACCTATGTCAATG -3'
(R):5'- TCCAGTAACTACATGAGGAAGGAC -3'

Sequencing Primer
(F):5'- AGCACCTATGTCAATGAACTGG -3'
(R):5'- CTACATGAGGAAGGACACTCGTTC -3'
Posted On2016-07-22