Incidental Mutation 'R5209:Fam81a'
ID403047
Institutional Source Beutler Lab
Gene Symbol Fam81a
Ensembl Gene ENSMUSG00000032224
Gene Namefamily with sequence similarity 81, member A
Synonyms
MMRRC Submission 042784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5209 (G1)
Quality Score159
Status Validated
Chromosome9
Chromosomal Location70088511-70142560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70125160 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 17 (T17A)
Ref Sequence ENSEMBL: ENSMUSP00000034749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034749] [ENSMUST00000123206] [ENSMUST00000141775]
Predicted Effect probably benign
Transcript: ENSMUST00000034749
AA Change: T17A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034749
Gene: ENSMUSG00000032224
AA Change: T17A

DomainStartEndE-ValueType
coiled coil region 75 106 N/A INTRINSIC
coiled coil region 158 187 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123206
AA Change: T17A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000141775
AA Change: T17A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,818 T4453A possibly damaging Het
Abca14 T C 7: 120,232,907 V500A probably benign Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Adgb C A 10: 10,398,937 V759L possibly damaging Het
Adprhl1 T A 8: 13,242,563 K243* probably null Het
Arhgap24 T A 5: 102,892,149 D317E probably benign Het
Arhgef5 A T 6: 43,273,700 I462F probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Btbd18 A G 2: 84,668,099 T694A possibly damaging Het
Ces1d A T 8: 93,175,188 probably benign Het
Chmp2a C A 7: 13,032,674 V106F probably damaging Het
Cinp T C 12: 110,874,060 E219G probably benign Het
Col5a3 C T 9: 20,778,643 probably benign Het
Dnhd1 T G 7: 105,696,460 S2271A probably benign Het
Epg5 T A 18: 77,951,282 L376H probably damaging Het
Fgd2 T A 17: 29,368,376 probably null Het
Gjc3 C T 5: 137,957,271 V251I probably benign Het
Gnaz T G 10: 74,991,991 F192V probably benign Het
Hmgcr T C 13: 96,666,512 probably benign Het
Mamdc4 G T 2: 25,566,923 A614E probably damaging Het
Mapk8ip2 A T 15: 89,459,287 Q713L probably damaging Het
Mettl1 T C 10: 127,045,334 V238A possibly damaging Het
Ms4a4c G A 19: 11,416,438 G74E probably damaging Het
Msh3 A G 13: 92,344,954 probably null Het
Mtmr14 T A 6: 113,253,775 Y113* probably null Het
Mylk T C 16: 34,922,625 L1169P possibly damaging Het
Npr3 A G 15: 11,848,603 V426A possibly damaging Het
Olfr105-ps T C 17: 37,382,830 S88P probably damaging Het
Olfr221 T C 14: 52,035,953 T53A probably benign Het
Olfr771 A C 10: 129,160,932 D17E possibly damaging Het
Olfr905 T A 9: 38,473,521 M258K possibly damaging Het
Pcdhb17 T C 18: 37,487,461 F768S probably damaging Het
Piezo2 T C 18: 63,032,929 N2077S probably damaging Het
Pkd1l2 G A 8: 117,056,442 P713L probably benign Het
Primpol T C 8: 46,590,260 T333A probably benign Het
Pth2r A T 1: 65,388,697 T510S probably benign Het
Ptprr A T 10: 116,162,609 E208V probably damaging Het
Rag1 T C 2: 101,644,215 Y194C probably benign Het
Reep5 A T 18: 34,357,240 probably null Het
Rexo5 T A 7: 119,834,299 Y493* probably null Het
Rgs9 T C 11: 109,239,594 probably null Het
Rps6ka1 A T 4: 133,865,818 V218D probably damaging Het
Satb1 A T 17: 51,809,207 M16K probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn14 A G 11: 83,279,633 F395S possibly damaging Het
Sptbn5 T A 2: 120,072,002 I82F probably benign Het
Stam T A 2: 14,146,347 I505K probably benign Het
Tesk2 G A 4: 116,724,698 probably benign Het
Trappc12 T C 12: 28,737,794 K430R probably benign Het
Trmo T C 4: 46,387,740 N34D probably damaging Het
Ubr2 C A 17: 46,968,424 C686F probably damaging Het
Vdac1 C T 11: 52,376,452 T60I probably damaging Het
Zfp652 G C 11: 95,763,665 R478P possibly damaging Het
Other mutations in Fam81a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Fam81a APN 9 70099152 nonsense probably null
IGL02010:Fam81a APN 9 70099137 missense probably benign 0.04
IGL02891:Fam81a APN 9 70110276 missense probably damaging 1.00
R0100:Fam81a UTSW 9 70102809 splice site probably benign
R0497:Fam81a UTSW 9 70096119 missense possibly damaging 0.47
R0621:Fam81a UTSW 9 70093647 missense probably benign 0.35
R1075:Fam81a UTSW 9 70110274 nonsense probably null
R1524:Fam81a UTSW 9 70125108 missense probably damaging 1.00
R4970:Fam81a UTSW 9 70093590 nonsense probably null
R5138:Fam81a UTSW 9 70099175 missense probably benign 0.01
R6139:Fam81a UTSW 9 70102818 critical splice donor site probably null
R6378:Fam81a UTSW 9 70110346 missense probably damaging 1.00
R7145:Fam81a UTSW 9 70110278 missense probably damaging 1.00
R8030:Fam81a UTSW 9 70102909 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTTCCAAGAACAGCCTGGC -3'
(R):5'- ATGGGCAGAATCACCTTAAAATCC -3'

Sequencing Primer
(F):5'- AACAGCCTGGCTAAGCG -3'
(R):5'- GCTCTCAAAGTAAACTCTTTTGGG -3'
Posted On2016-07-22