Incidental Mutation 'R5209:Gnaz'
ID403049
Institutional Source Beutler Lab
Gene Symbol Gnaz
Ensembl Gene ENSMUSG00000040009
Gene Nameguanine nucleotide binding protein, alpha z subunit
SynonymsGz
MMRRC Submission 042784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5209 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location74967177-75016907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74991991 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 192 (F192V)
Ref Sequence ENSEMBL: ENSMUSP00000124639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009214] [ENSMUST00000037813] [ENSMUST00000159991] [ENSMUST00000160072] [ENSMUST00000160450] [ENSMUST00000166088] [ENSMUST00000179546]
Predicted Effect probably benign
Transcript: ENSMUST00000009214
SMART Domains Protein: ENSMUSP00000009214
Gene: ENSMUSG00000009070

DomainStartEndE-ValueType
Pfam:HEAT_2 28 133 9.9e-8 PFAM
ARM 138 178 3.18e1 SMART
ARM 218 258 1.88e0 SMART
ARM 259 300 3.32e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037813
AA Change: F192V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036087
Gene: ENSMUSG00000040009
AA Change: F192V

DomainStartEndE-ValueType
G_alpha 13 354 1.05e-210 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159991
AA Change: F192V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124639
Gene: ENSMUSG00000040009
AA Change: F192V

DomainStartEndE-ValueType
G_alpha 13 354 1.05e-210 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160072
SMART Domains Protein: ENSMUSP00000123760
Gene: ENSMUSG00000009070

DomainStartEndE-ValueType
Pfam:HEAT_2 28 133 1.6e-8 PFAM
Blast:ARM 138 161 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160421
Predicted Effect probably benign
Transcript: ENSMUST00000160450
SMART Domains Protein: ENSMUSP00000125289
Gene: ENSMUSG00000009070

DomainStartEndE-ValueType
Pfam:HEAT_2 28 133 4.1e-8 PFAM
Blast:ARM 138 178 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166088
SMART Domains Protein: ENSMUSP00000131632
Gene: ENSMUSG00000009070

DomainStartEndE-ValueType
Blast:ARM 48 88 1e-7 BLAST
Blast:ARM 89 129 3e-16 BLAST
ARM 171 211 3.18e1 SMART
ARM 251 291 1.88e0 SMART
ARM 292 333 3.32e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179546
SMART Domains Protein: ENSMUSP00000136715
Gene: ENSMUSG00000009070

DomainStartEndE-ValueType
Pfam:HEAT_2 28 133 9.9e-8 PFAM
ARM 138 178 3.18e1 SMART
ARM 218 258 1.88e0 SMART
ARM 259 300 3.32e-1 SMART
Meta Mutation Damage Score 0.1271 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a G protein subfamily that mediates signal transduction in pertussis toxin-insensitive systms. This encoded protein may play a role in maintaining the ionic balance of perilymphatic and endolymphatic cochlear fluids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypertolerance to morphine. Mice homozygous for a reporter allele exhibit impaired platelet aggregation, increased resistance to fatal thromboembolism, reduced morphine-elicited antinociception, and altered behavioral responses to addictive substances. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,818 T4453A possibly damaging Het
Abca14 T C 7: 120,232,907 V500A probably benign Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Adgb C A 10: 10,398,937 V759L possibly damaging Het
Adprhl1 T A 8: 13,242,563 K243* probably null Het
Arhgap24 T A 5: 102,892,149 D317E probably benign Het
Arhgef5 A T 6: 43,273,700 I462F probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Btbd18 A G 2: 84,668,099 T694A possibly damaging Het
Ces1d A T 8: 93,175,188 probably benign Het
Chmp2a C A 7: 13,032,674 V106F probably damaging Het
Cinp T C 12: 110,874,060 E219G probably benign Het
Col5a3 C T 9: 20,778,643 probably benign Het
Dnhd1 T G 7: 105,696,460 S2271A probably benign Het
Epg5 T A 18: 77,951,282 L376H probably damaging Het
Fam81a T C 9: 70,125,160 T17A probably benign Het
Fgd2 T A 17: 29,368,376 probably null Het
Gjc3 C T 5: 137,957,271 V251I probably benign Het
Hmgcr T C 13: 96,666,512 probably benign Het
Mamdc4 G T 2: 25,566,923 A614E probably damaging Het
Mapk8ip2 A T 15: 89,459,287 Q713L probably damaging Het
Mettl1 T C 10: 127,045,334 V238A possibly damaging Het
Ms4a4c G A 19: 11,416,438 G74E probably damaging Het
Msh3 A G 13: 92,344,954 probably null Het
Mtmr14 T A 6: 113,253,775 Y113* probably null Het
Mylk T C 16: 34,922,625 L1169P possibly damaging Het
Npr3 A G 15: 11,848,603 V426A possibly damaging Het
Olfr105-ps T C 17: 37,382,830 S88P probably damaging Het
Olfr221 T C 14: 52,035,953 T53A probably benign Het
Olfr771 A C 10: 129,160,932 D17E possibly damaging Het
Olfr905 T A 9: 38,473,521 M258K possibly damaging Het
Pcdhb17 T C 18: 37,487,461 F768S probably damaging Het
Piezo2 T C 18: 63,032,929 N2077S probably damaging Het
Pkd1l2 G A 8: 117,056,442 P713L probably benign Het
Primpol T C 8: 46,590,260 T333A probably benign Het
Pth2r A T 1: 65,388,697 T510S probably benign Het
Ptprr A T 10: 116,162,609 E208V probably damaging Het
Rag1 T C 2: 101,644,215 Y194C probably benign Het
Reep5 A T 18: 34,357,240 probably null Het
Rexo5 T A 7: 119,834,299 Y493* probably null Het
Rgs9 T C 11: 109,239,594 probably null Het
Rps6ka1 A T 4: 133,865,818 V218D probably damaging Het
Satb1 A T 17: 51,809,207 M16K probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn14 A G 11: 83,279,633 F395S possibly damaging Het
Sptbn5 T A 2: 120,072,002 I82F probably benign Het
Stam T A 2: 14,146,347 I505K probably benign Het
Tesk2 G A 4: 116,724,698 probably benign Het
Trappc12 T C 12: 28,737,794 K430R probably benign Het
Trmo T C 4: 46,387,740 N34D probably damaging Het
Ubr2 C A 17: 46,968,424 C686F probably damaging Het
Vdac1 C T 11: 52,376,452 T60I probably damaging Het
Zfp652 G C 11: 95,763,665 R478P possibly damaging Het
Other mutations in Gnaz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Gnaz APN 10 74991944 missense probably damaging 1.00
IGL01942:Gnaz APN 10 75014874 missense probably damaging 1.00
IGL02695:Gnaz APN 10 74992142 critical splice donor site probably null
R0039:Gnaz UTSW 10 75015034 missense probably damaging 1.00
R1768:Gnaz UTSW 10 74991870 missense possibly damaging 0.77
R4924:Gnaz UTSW 10 74991713 missense probably benign 0.00
R5747:Gnaz UTSW 10 74991403 intron probably benign
R5798:Gnaz UTSW 10 75014871 missense probably damaging 1.00
R6976:Gnaz UTSW 10 74991436 missense possibly damaging 0.63
Z1177:Gnaz UTSW 10 75014960 missense
Predicted Primers PCR Primer
(F):5'- GATTACACCTGAGCTGCTGG -3'
(R):5'- ACAAGTCCACCTGCTTCCTG -3'

Sequencing Primer
(F):5'- TGTCATGCGACGGCTCTG -3'
(R):5'- CACCTGCTTCCTGGGAAC -3'
Posted On2016-07-22