Incidental Mutation 'R5209:Rgs9'
ID403057
Institutional Source Beutler Lab
Gene Symbol Rgs9
Ensembl Gene ENSMUSG00000020599
Gene Nameregulator of G-protein signaling 9
SynonymsRgs9-2, RGS9-1
MMRRC Submission 042784-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5209 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109225355-109298129 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 109239594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020920] [ENSMUST00000103062] [ENSMUST00000103062] [ENSMUST00000106706]
Predicted Effect probably null
Transcript: ENSMUST00000020920
SMART Domains Protein: ENSMUSP00000020920
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
low complexity region 486 504 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103062
SMART Domains Protein: ENSMUSP00000099351
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
G_gamma 1 54 2.27e-6 SMART
GGL 1 54 1.86e-15 SMART
RGS 73 188 4.47e-48 SMART
low complexity region 260 278 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103062
SMART Domains Protein: ENSMUSP00000099351
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
G_gamma 1 54 2.27e-6 SMART
GGL 1 54 1.86e-15 SMART
RGS 73 188 4.47e-48 SMART
low complexity region 260 278 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106706
SMART Domains Protein: ENSMUSP00000102317
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156785
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, relative to wild-type, homozygous null photoreceptors display abnormally retarded recovery of their light responses, and slowed rates of GTP hydrolysis by transducin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,818 T4453A possibly damaging Het
Abca14 T C 7: 120,232,907 V500A probably benign Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Adgb C A 10: 10,398,937 V759L possibly damaging Het
Adprhl1 T A 8: 13,242,563 K243* probably null Het
Arhgap24 T A 5: 102,892,149 D317E probably benign Het
Arhgef5 A T 6: 43,273,700 I462F probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Btbd18 A G 2: 84,668,099 T694A possibly damaging Het
Ces1d A T 8: 93,175,188 probably benign Het
Chmp2a C A 7: 13,032,674 V106F probably damaging Het
Cinp T C 12: 110,874,060 E219G probably benign Het
Col5a3 C T 9: 20,778,643 probably benign Het
Dnhd1 T G 7: 105,696,460 S2271A probably benign Het
Epg5 T A 18: 77,951,282 L376H probably damaging Het
Fam81a T C 9: 70,125,160 T17A probably benign Het
Fgd2 T A 17: 29,368,376 probably null Het
Gjc3 C T 5: 137,957,271 V251I probably benign Het
Gnaz T G 10: 74,991,991 F192V probably benign Het
Hmgcr T C 13: 96,666,512 probably benign Het
Mamdc4 G T 2: 25,566,923 A614E probably damaging Het
Mapk8ip2 A T 15: 89,459,287 Q713L probably damaging Het
Mettl1 T C 10: 127,045,334 V238A possibly damaging Het
Ms4a4c G A 19: 11,416,438 G74E probably damaging Het
Msh3 A G 13: 92,344,954 probably null Het
Mtmr14 T A 6: 113,253,775 Y113* probably null Het
Mylk T C 16: 34,922,625 L1169P possibly damaging Het
Npr3 A G 15: 11,848,603 V426A possibly damaging Het
Olfr105-ps T C 17: 37,382,830 S88P probably damaging Het
Olfr221 T C 14: 52,035,953 T53A probably benign Het
Olfr771 A C 10: 129,160,932 D17E possibly damaging Het
Olfr905 T A 9: 38,473,521 M258K possibly damaging Het
Pcdhb17 T C 18: 37,487,461 F768S probably damaging Het
Piezo2 T C 18: 63,032,929 N2077S probably damaging Het
Pkd1l2 G A 8: 117,056,442 P713L probably benign Het
Primpol T C 8: 46,590,260 T333A probably benign Het
Pth2r A T 1: 65,388,697 T510S probably benign Het
Ptprr A T 10: 116,162,609 E208V probably damaging Het
Rag1 T C 2: 101,644,215 Y194C probably benign Het
Reep5 A T 18: 34,357,240 probably null Het
Rexo5 T A 7: 119,834,299 Y493* probably null Het
Rps6ka1 A T 4: 133,865,818 V218D probably damaging Het
Satb1 A T 17: 51,809,207 M16K probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn14 A G 11: 83,279,633 F395S possibly damaging Het
Sptbn5 T A 2: 120,072,002 I82F probably benign Het
Stam T A 2: 14,146,347 I505K probably benign Het
Tesk2 G A 4: 116,724,698 probably benign Het
Trappc12 T C 12: 28,737,794 K430R probably benign Het
Trmo T C 4: 46,387,740 N34D probably damaging Het
Ubr2 C A 17: 46,968,424 C686F probably damaging Het
Vdac1 C T 11: 52,376,452 T60I probably damaging Het
Zfp652 G C 11: 95,763,665 R478P possibly damaging Het
Other mutations in Rgs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Rgs9 APN 11 109249049 splice site probably benign
IGL01949:Rgs9 APN 11 109259834 critical splice donor site probably null
IGL02479:Rgs9 APN 11 109225652 missense possibly damaging 0.51
IGL03170:Rgs9 APN 11 109259855 missense probably benign 0.10
R1368:Rgs9 UTSW 11 109248151 missense probably benign 0.00
R1499:Rgs9 UTSW 11 109268921 critical splice donor site probably null
R1780:Rgs9 UTSW 11 109239499 nonsense probably null
R2422:Rgs9 UTSW 11 109225777 critical splice acceptor site probably null
R2509:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2510:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2511:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R3932:Rgs9 UTSW 11 109275813 splice site probably benign
R4179:Rgs9 UTSW 11 109281448 critical splice donor site probably null
R4801:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4802:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4928:Rgs9 UTSW 11 109225744 missense probably benign 0.08
R5073:Rgs9 UTSW 11 109227331 missense probably benign 0.03
R5286:Rgs9 UTSW 11 109239451 splice site probably null
R5449:Rgs9 UTSW 11 109225744 missense probably benign
R6046:Rgs9 UTSW 11 109239560 missense probably damaging 1.00
R6267:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R6296:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R7325:Rgs9 UTSW 11 109276581 missense probably damaging 1.00
R7453:Rgs9 UTSW 11 109227268 missense probably damaging 1.00
R7864:Rgs9 UTSW 11 109275620 missense probably damaging 1.00
R7947:Rgs9 UTSW 11 109275620 missense probably damaging 1.00
R8035:Rgs9 UTSW 11 109273324 missense probably benign 0.28
Z1177:Rgs9 UTSW 11 109239592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCACATCTAAGGAGCTTTCC -3'
(R):5'- AAACATTCCATTCTCAAGTCTGCC -3'

Sequencing Primer
(F):5'- CACATCTAAGGAGCTTTCCTGGTAAC -3'
(R):5'- AAGTCTGCCATGATCTTATCCTGG -3'
Posted On2016-07-22