Incidental Mutation 'R5209:Fgd2'
ID 403067
Institutional Source Beutler Lab
Gene Symbol Fgd2
Ensembl Gene ENSMUSG00000024013
Gene Name FYVE, RhoGEF and PH domain containing 2
Synonyms tcs2, Tcd-2, Tcd2, tcs-2
MMRRC Submission 042784-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R5209 (G1)
Quality Score 188
Status Validated
Chromosome 17
Chromosomal Location 29579878-29598509 bp(+) (GRCm39)
Type of Mutation splice site (46 bp from exon)
DNA Base Change (assembly) T to A at 29587350 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024810] [ENSMUST00000123989]
AlphaFold Q8BY35
Predicted Effect probably null
Transcript: ENSMUST00000024810
SMART Domains Protein: ENSMUSP00000024810
Gene: ENSMUSG00000024013

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
PH 320 420 2.09e-16 SMART
FYVE 450 519 1.07e-28 SMART
PH 545 643 5.09e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123989
SMART Domains Protein: ENSMUSP00000118828
Gene: ENSMUSG00000024013

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146800
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,832,130 (GRCm39) V500A probably benign Het
Abcg4 A G 9: 44,186,672 (GRCm39) Y491H probably damaging Het
Adgb C A 10: 10,274,681 (GRCm39) V759L possibly damaging Het
Adprhl1 T A 8: 13,292,563 (GRCm39) K243* probably null Het
Arhgap24 T A 5: 103,040,015 (GRCm39) D317E probably benign Het
Arhgef5 A T 6: 43,250,634 (GRCm39) I462F probably benign Het
Birc6 A C 17: 74,977,369 (GRCm39) N4388T probably damaging Het
Btbd18 A G 2: 84,498,443 (GRCm39) T694A possibly damaging Het
Ces1d A T 8: 93,901,816 (GRCm39) probably benign Het
Chmp2a C A 7: 12,766,601 (GRCm39) V106F probably damaging Het
Cinp T C 12: 110,840,494 (GRCm39) E219G probably benign Het
Col5a3 C T 9: 20,689,939 (GRCm39) probably benign Het
Dnhd1 T G 7: 105,345,667 (GRCm39) S2271A probably benign Het
Epg5 T A 18: 77,994,497 (GRCm39) L376H probably damaging Het
Fam81a T C 9: 70,032,442 (GRCm39) T17A probably benign Het
Gjc3 C T 5: 137,955,533 (GRCm39) V251I probably benign Het
Gnaz T G 10: 74,827,823 (GRCm39) F192V probably benign Het
Hmgcr T C 13: 96,803,020 (GRCm39) probably benign Het
Mamdc4 G T 2: 25,456,935 (GRCm39) A614E probably damaging Het
Mapk8ip2 A T 15: 89,343,490 (GRCm39) Q713L probably damaging Het
Mettl1 T C 10: 126,881,203 (GRCm39) V238A possibly damaging Het
Ms4a4c G A 19: 11,393,802 (GRCm39) G74E probably damaging Het
Msh3 A G 13: 92,481,462 (GRCm39) probably null Het
Mtmr14 T A 6: 113,230,736 (GRCm39) Y113* probably null Het
Mylk T C 16: 34,742,995 (GRCm39) L1169P possibly damaging Het
Npr3 A G 15: 11,848,689 (GRCm39) V426A possibly damaging Het
Or12d15 T C 17: 37,693,721 (GRCm39) S88P probably damaging Het
Or5au1 T C 14: 52,273,410 (GRCm39) T53A probably benign Het
Or6c202 A C 10: 128,996,801 (GRCm39) D17E possibly damaging Het
Or8b1c T A 9: 38,384,817 (GRCm39) M258K possibly damaging Het
Pcdhb17 T C 18: 37,620,514 (GRCm39) F768S probably damaging Het
Piezo2 T C 18: 63,166,000 (GRCm39) N2077S probably damaging Het
Pkd1l2 G A 8: 117,783,181 (GRCm39) P713L probably benign Het
Primpol T C 8: 47,043,295 (GRCm39) T333A probably benign Het
Pth2r A T 1: 65,427,856 (GRCm39) T510S probably benign Het
Ptprr A T 10: 115,998,514 (GRCm39) E208V probably damaging Het
Rag1 T C 2: 101,474,560 (GRCm39) Y194C probably benign Het
Reep5 A T 18: 34,490,293 (GRCm39) probably null Het
Rexo5 T A 7: 119,433,522 (GRCm39) Y493* probably null Het
Rgs9 T C 11: 109,130,420 (GRCm39) probably null Het
Rps6ka1 A T 4: 133,593,129 (GRCm39) V218D probably damaging Het
Satb1 A T 17: 52,116,235 (GRCm39) M16K probably benign Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Slfn14 A G 11: 83,170,459 (GRCm39) F395S possibly damaging Het
Spata31h1 T C 10: 82,119,652 (GRCm39) T4453A possibly damaging Het
Sptbn5 T A 2: 119,902,483 (GRCm39) I82F probably benign Het
Stam T A 2: 14,151,158 (GRCm39) I505K probably benign Het
Tesk2 G A 4: 116,581,895 (GRCm39) probably benign Het
Trappc12 T C 12: 28,787,793 (GRCm39) K430R probably benign Het
Trmo T C 4: 46,387,740 (GRCm39) N34D probably damaging Het
Ubr2 C A 17: 47,279,350 (GRCm39) C686F probably damaging Het
Vdac1 C T 11: 52,267,279 (GRCm39) T60I probably damaging Het
Zfp652 G C 11: 95,654,491 (GRCm39) R478P possibly damaging Het
Other mutations in Fgd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Fgd2 APN 17 29,586,949 (GRCm39) missense probably damaging 1.00
IGL01505:Fgd2 APN 17 29,585,971 (GRCm39) missense probably damaging 1.00
IGL03240:Fgd2 APN 17 29,580,135 (GRCm39) splice site probably benign
ceci UTSW 17 29,587,350 (GRCm39) splice site probably null
R0046:Fgd2 UTSW 17 29,593,964 (GRCm39) splice site probably benign
R0271:Fgd2 UTSW 17 29,585,982 (GRCm39) missense possibly damaging 0.94
R0594:Fgd2 UTSW 17 29,584,526 (GRCm39) missense probably damaging 1.00
R0612:Fgd2 UTSW 17 29,597,321 (GRCm39) missense probably benign 0.45
R1470:Fgd2 UTSW 17 29,593,082 (GRCm39) splice site probably benign
R1551:Fgd2 UTSW 17 29,597,383 (GRCm39) missense probably damaging 1.00
R1596:Fgd2 UTSW 17 29,595,904 (GRCm39) missense probably benign 0.43
R1664:Fgd2 UTSW 17 29,588,273 (GRCm39) missense probably damaging 1.00
R1689:Fgd2 UTSW 17 29,582,696 (GRCm39) missense probably benign
R1691:Fgd2 UTSW 17 29,597,918 (GRCm39) nonsense probably null
R1695:Fgd2 UTSW 17 29,587,219 (GRCm39) missense possibly damaging 0.88
R2697:Fgd2 UTSW 17 29,595,895 (GRCm39) missense probably damaging 1.00
R3500:Fgd2 UTSW 17 29,584,575 (GRCm39) missense possibly damaging 0.74
R3689:Fgd2 UTSW 17 29,597,924 (GRCm39) missense probably benign 0.00
R4583:Fgd2 UTSW 17 29,586,052 (GRCm39) missense possibly damaging 0.87
R4871:Fgd2 UTSW 17 29,592,223 (GRCm39) missense possibly damaging 0.89
R5011:Fgd2 UTSW 17 29,593,954 (GRCm39) critical splice donor site probably null
R7106:Fgd2 UTSW 17 29,595,944 (GRCm39) nonsense probably null
R7139:Fgd2 UTSW 17 29,592,229 (GRCm39) missense probably damaging 1.00
R7712:Fgd2 UTSW 17 29,595,886 (GRCm39) missense probably benign 0.01
R7833:Fgd2 UTSW 17 29,586,369 (GRCm39) missense possibly damaging 0.81
R7834:Fgd2 UTSW 17 29,583,925 (GRCm39) missense probably damaging 1.00
R7913:Fgd2 UTSW 17 29,593,019 (GRCm39) missense probably damaging 1.00
R8547:Fgd2 UTSW 17 29,583,934 (GRCm39) missense probably damaging 0.99
R8686:Fgd2 UTSW 17 29,597,997 (GRCm39) missense probably benign
R9088:Fgd2 UTSW 17 29,583,913 (GRCm39) missense probably damaging 1.00
R9525:Fgd2 UTSW 17 29,583,955 (GRCm39) missense probably damaging 1.00
R9601:Fgd2 UTSW 17 29,593,860 (GRCm39) missense probably benign 0.09
Z1177:Fgd2 UTSW 17 29,597,300 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATGTGTACCAGCGCCTG -3'
(R):5'- AGGAATACACCTCAAGATAGCC -3'

Sequencing Primer
(F):5'- CCTGGGCTTGGAGGATGACATC -3'
(R):5'- AATGCCTTGGCATGGACC -3'
Posted On 2016-07-22