Mutagenetix > Incidental Mutations

Incidental Mutation 'R5209:Epg5'

403075

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

042784-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R5209 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 77951282 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 376 (L376H)

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044622
AA Change: L376H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: L376H

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Meta Mutation Damage Score

0.1075

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,283,818	T4453A	possibly damaging	Het
Abca14	T	C	7: 120,232,907	V500A	probably benign	Het
Abcg4	A	G	9: 44,275,375	Y491H	probably damaging	Het
Adgb	C	A	10: 10,398,937	V759L	possibly damaging	Het
Adprhl1	T	A	8: 13,242,563	K243*	probably null	Het
Arhgap24	T	A	5: 102,892,149	D317E	probably benign	Het
Arhgef5	A	T	6: 43,273,700	I462F	probably benign	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
Btbd18	A	G	2: 84,668,099	T694A	possibly damaging	Het
Ces1d	A	T	8: 93,175,188		probably benign	Het
Chmp2a	C	A	7: 13,032,674	V106F	probably damaging	Het
Cinp	T	C	12: 110,874,060	E219G	probably benign	Het
Col5a3	C	T	9: 20,778,643		probably benign	Het
Dnhd1	T	G	7: 105,696,460	S2271A	probably benign	Het
Fam81a	T	C	9: 70,125,160	T17A	probably benign	Het
Fgd2	T	A	17: 29,368,376		probably null	Het
Gjc3	C	T	5: 137,957,271	V251I	probably benign	Het
Gnaz	T	G	10: 74,991,991	F192V	probably benign	Het
Hmgcr	T	C	13: 96,666,512		probably benign	Het
Mamdc4	G	T	2: 25,566,923	A614E	probably damaging	Het
Mapk8ip2	A	T	15: 89,459,287	Q713L	probably damaging	Het
Mettl1	T	C	10: 127,045,334	V238A	possibly damaging	Het
Ms4a4c	G	A	19: 11,416,438	G74E	probably damaging	Het
Msh3	A	G	13: 92,344,954		probably null	Het
Mtmr14	T	A	6: 113,253,775	Y113*	probably null	Het
Mylk	T	C	16: 34,922,625	L1169P	possibly damaging	Het
Npr3	A	G	15: 11,848,603	V426A	possibly damaging	Het
Olfr105-ps	T	C	17: 37,382,830	S88P	probably damaging	Het
Olfr221	T	C	14: 52,035,953	T53A	probably benign	Het
Olfr771	A	C	10: 129,160,932	D17E	possibly damaging	Het
Olfr905	T	A	9: 38,473,521	M258K	possibly damaging	Het
Pcdhb17	T	C	18: 37,487,461	F768S	probably damaging	Het
Piezo2	T	C	18: 63,032,929	N2077S	probably damaging	Het
Pkd1l2	G	A	8: 117,056,442	P713L	probably benign	Het
Primpol	T	C	8: 46,590,260	T333A	probably benign	Het
Pth2r	A	T	1: 65,388,697	T510S	probably benign	Het
Ptprr	A	T	10: 116,162,609	E208V	probably damaging	Het
Rag1	T	C	2: 101,644,215	Y194C	probably benign	Het
Reep5	A	T	18: 34,357,240		probably null	Het
Rexo5	T	A	7: 119,834,299	Y493*	probably null	Het
Rgs9	T	C	11: 109,239,594		probably null	Het
Rps6ka1	A	T	4: 133,865,818	V218D	probably damaging	Het
Satb1	A	T	17: 51,809,207	M16K	probably benign	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slfn14	A	G	11: 83,279,633	F395S	possibly damaging	Het
Sptbn5	T	A	2: 120,072,002	I82F	probably benign	Het
Stam	T	A	2: 14,146,347	I505K	probably benign	Het
Tesk2	G	A	4: 116,724,698		probably benign	Het
Trappc12	T	C	12: 28,737,794	K430R	probably benign	Het
Trmo	T	C	4: 46,387,740	N34D	probably damaging	Het
Ubr2	C	A	17: 46,968,424	C686F	probably damaging	Het
Vdac1	C	T	11: 52,376,452	T60I	probably damaging	Het
Zfp652	G	C	11: 95,763,665	R478P	possibly damaging	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAATAGTGCCAGAGCCTGC -3'
(R):5'- TGTTAGGGTCTGGCCAACTC -3'

Sequencing Primer
(F):5'- ATAGTGCCAGAGCCTGCAAGTC -3'
(R):5'- TCTGGCCAACTCAGTCAGG -3'

Posted On

2016-07-22