Incidental Mutation 'R0416:Olfr444'
ID40308
Institutional Source Beutler Lab
Gene Symbol Olfr444
Ensembl Gene ENSMUSG00000073110
Gene Nameolfactory receptor 444
SynonymsMOR261-2, GA_x6K02T2P3E9-4602571-4601639
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0416 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42949067-42956764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42955570 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 24 (C24Y)
Ref Sequence ENSEMBL: ENSMUSP00000144691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095955] [ENSMUST00000204092]
Predicted Effect probably benign
Transcript: ENSMUST00000095955
AA Change: C24Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093649
Gene: ENSMUSG00000073110
AA Change: C24Y

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1e-60 PFAM
Pfam:7tm_1 40 289 6.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204092
AA Change: C24Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144691
Gene: ENSMUSG00000073110
AA Change: C24Y

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Olfr444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Olfr444 APN 6 42956436 utr 3 prime probably benign
IGL02135:Olfr444 APN 6 42955651 missense probably damaging 0.99
IGL02323:Olfr444 APN 6 42955983 missense probably benign 0.02
IGL02398:Olfr444 APN 6 42956112 missense probably benign 0.02
IGL02622:Olfr444 APN 6 42955729 missense probably damaging 0.99
R0077:Olfr444 UTSW 6 42955773 missense probably benign 0.13
R0959:Olfr444 UTSW 6 42955752 missense probably benign
R1181:Olfr444 UTSW 6 42955558 missense probably benign 0.23
R1347:Olfr444 UTSW 6 42955705 missense probably damaging 1.00
R1347:Olfr444 UTSW 6 42955705 missense probably damaging 1.00
R1604:Olfr444 UTSW 6 42955716 missense possibly damaging 0.73
R3021:Olfr444 UTSW 6 42956184 missense possibly damaging 0.91
R4226:Olfr444 UTSW 6 42955755 missense probably benign
R4227:Olfr444 UTSW 6 42955714 missense possibly damaging 0.95
R4776:Olfr444 UTSW 6 42955521 missense probably benign 0.00
R5941:Olfr444 UTSW 6 42955716 missense possibly damaging 0.86
R7539:Olfr444 UTSW 6 42956103 missense possibly damaging 0.95
R7763:Olfr444 UTSW 6 42955789 missense probably benign 0.00
X0063:Olfr444 UTSW 6 42956019 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCAGTGTCCTAAGACACAGCCAGAC -3'
(R):5'- GCCAGGATGGTACACACTTTCCAAC -3'

Sequencing Primer
(F):5'- GACACAGCCAGACATTTTCTTC -3'
(R):5'- ATCAGGCATTCTGTGCAAGC -3'
Posted On2013-05-23