Incidental Mutation 'R5210:Pou3f2'
ID403082
Institutional Source Beutler Lab
Gene Symbol Pou3f2
Ensembl Gene ENSMUSG00000095139
Gene NamePOU domain, class 3, transcription factor 2
SynonymsOtf7, Brn-2, Brn2, A230098E07Rik, 9430075J19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5210 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location22482780-22488366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22487324 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 270 (D270N)
Ref Sequence ENSEMBL: ENSMUSP00000136147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178174]
Predicted Effect probably damaging
Transcript: ENSMUST00000178174
AA Change: D270N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136147
Gene: ENSMUSG00000095139
AA Change: D270N

DomainStartEndE-ValueType
coiled coil region 122 152 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 220 261 N/A INTRINSIC
POU 264 338 9.06e-54 SMART
HOX 356 418 4.2e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203909
Meta Mutation Damage Score 0.1969 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU-III class of neural transcription factors. The encoded protein is involved in neuronal differentiation and enhances the activation of corticotropin-releasing hormone regulated genes. Overexpression of this protein is associated with an increase in the proliferation of melanoma cells. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous mutation of this gene results in lethality by 10 days of age. Mutant animals are growth retarded, have hyperkeratotic, flaky skin, and exhibit loss of the posterior pituitary and disruption of late endocrine hypothalamic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,068,110 I399V probably benign Het
4932438A13Rik T C 3: 37,033,265 V710A possibly damaging Het
Ablim2 T A 5: 35,837,072 V342E probably benign Het
Adgre4 T A 17: 55,785,029 N96K probably damaging Het
Ccdc171 A G 4: 83,554,856 E174G probably damaging Het
Col11a1 T C 3: 114,153,157 F1026S probably damaging Het
Coro1c A G 5: 113,845,306 L387P probably damaging Het
Dsg1c C T 18: 20,274,701 T368I probably damaging Het
Exoc3l4 C A 12: 111,428,841 probably benign Het
Extl1 T C 4: 134,360,584 D453G probably benign Het
Gm21136 T C 7: 38,867,741 noncoding transcript Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Ifi208 T C 1: 173,683,265 S329P probably benign Het
Iscu T A 5: 113,776,973 L182* probably null Het
Klra6 T A 6: 130,018,892 K168* probably null Het
Map3k5 T C 10: 20,024,901 S274P possibly damaging Het
Megf6 G T 4: 154,269,816 probably benign Het
Mmp12 T A 9: 7,349,729 Y53* probably null Het
Nucb2 T A 7: 116,528,987 Y278N probably damaging Het
Numa1 C A 7: 101,999,981 A973E probably benign Het
Olfr1369-ps1 A T 13: 21,116,052 Y120F probably damaging Het
Olfr1487 A G 19: 13,619,399 K79R probably damaging Het
Olfr830 T A 9: 18,875,807 L157Q probably damaging Het
Olfr99 C A 17: 37,279,933 K162N probably benign Het
Pcdhga3 C A 18: 37,675,910 T472K probably benign Het
Pclo A G 5: 14,713,450 D694G probably damaging Het
Plch1 A G 3: 63,699,778 probably null Het
Prrc2a G A 17: 35,153,620 R1682W probably damaging Het
Rb1 A G 14: 73,199,311 F838S probably damaging Het
Sec24c A G 14: 20,691,804 E769G probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tmem63c A T 12: 87,089,398 E796V probably benign Het
Tomm70a G A 16: 57,133,251 probably null Het
Tpcn1 G A 5: 120,539,214 T676I probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Pou3f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Pou3f2 APN 4 22487020 missense probably damaging 1.00
PIT4260001:Pou3f2 UTSW 4 22487291 missense possibly damaging 0.59
R0141:Pou3f2 UTSW 4 22487210 missense possibly damaging 0.91
R0739:Pou3f2 UTSW 4 22486960 missense possibly damaging 0.88
R1054:Pou3f2 UTSW 4 22487536 missense possibly damaging 0.85
R1163:Pou3f2 UTSW 4 22487697 small deletion probably benign
R1351:Pou3f2 UTSW 4 22487162 missense probably damaging 0.99
R1482:Pou3f2 UTSW 4 22486960 missense possibly damaging 0.83
R1708:Pou3f2 UTSW 4 22487255 missense possibly damaging 0.85
R1865:Pou3f2 UTSW 4 22486917 nonsense probably null
R1918:Pou3f2 UTSW 4 22487119 missense probably damaging 0.98
R1919:Pou3f2 UTSW 4 22487119 missense probably damaging 0.98
R2071:Pou3f2 UTSW 4 22488076 missense probably benign 0.07
R4985:Pou3f2 UTSW 4 22487588 missense probably benign 0.26
R6174:Pou3f2 UTSW 4 22486960 missense possibly damaging 0.88
R7134:Pou3f2 UTSW 4 22486874 missense probably benign 0.00
R7197:Pou3f2 UTSW 4 22487288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTGCACATGTTCTTGAAGC -3'
(R):5'- TATTCGCAGCCGAGCTTCAC -3'

Sequencing Primer
(F):5'- GCACATGTTCTTGAAGCTCAGCTG -3'
(R):5'- CCGAGCTTCACGGTGAAC -3'
Posted On2016-07-22