Incidental Mutation 'R5210:Ccdc171'
ID403083
Institutional Source Beutler Lab
Gene Symbol Ccdc171
Ensembl Gene ENSMUSG00000052407
Gene Namecoiled-coil domain containing 171
Synonyms4930473A06Rik, 4930418J05Rik, A330015D16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R5210 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location83525545-83864670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83554856 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 174 (E174G)
Ref Sequence ENSEMBL: ENSMUSP00000116486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053414] [ENSMUST00000125077] [ENSMUST00000126429] [ENSMUST00000231339]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053414
AA Change: E174G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056520
Gene: ENSMUSG00000052407
AA Change: E174G

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 527 N/A INTRINSIC
coiled coil region 599 628 N/A INTRINSIC
coiled coil region 653 712 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 783 797 N/A INTRINSIC
coiled coil region 981 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107202
SMART Domains Protein: ENSMUSP00000102820
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 21 125 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125077
AA Change: E174G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116486
Gene: ENSMUSG00000052407
AA Change: E174G

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 535 N/A INTRINSIC
coiled coil region 607 636 N/A INTRINSIC
coiled coil region 661 720 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
coiled coil region 989 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126429
SMART Domains Protein: ENSMUSP00000138195
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 91 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000231339
AA Change: E174G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0821 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice that either homozygous or heterozygous for an ENU-induced single point mutation exhibit decreased mature B cell number, decreased IgD level, and increased IgM level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,068,110 I399V probably benign Het
4932438A13Rik T C 3: 37,033,265 V710A possibly damaging Het
Ablim2 T A 5: 35,837,072 V342E probably benign Het
Adgre4 T A 17: 55,785,029 N96K probably damaging Het
Col11a1 T C 3: 114,153,157 F1026S probably damaging Het
Coro1c A G 5: 113,845,306 L387P probably damaging Het
Dsg1c C T 18: 20,274,701 T368I probably damaging Het
Exoc3l4 C A 12: 111,428,841 probably benign Het
Extl1 T C 4: 134,360,584 D453G probably benign Het
Gm21136 T C 7: 38,867,741 noncoding transcript Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Ifi208 T C 1: 173,683,265 S329P probably benign Het
Iscu T A 5: 113,776,973 L182* probably null Het
Klra6 T A 6: 130,018,892 K168* probably null Het
Map3k5 T C 10: 20,024,901 S274P possibly damaging Het
Megf6 G T 4: 154,269,816 probably benign Het
Mmp12 T A 9: 7,349,729 Y53* probably null Het
Nucb2 T A 7: 116,528,987 Y278N probably damaging Het
Numa1 C A 7: 101,999,981 A973E probably benign Het
Olfr1369-ps1 A T 13: 21,116,052 Y120F probably damaging Het
Olfr1487 A G 19: 13,619,399 K79R probably damaging Het
Olfr830 T A 9: 18,875,807 L157Q probably damaging Het
Olfr99 C A 17: 37,279,933 K162N probably benign Het
Pcdhga3 C A 18: 37,675,910 T472K probably benign Het
Pclo A G 5: 14,713,450 D694G probably damaging Het
Plch1 A G 3: 63,699,778 probably null Het
Pou3f2 C T 4: 22,487,324 D270N probably damaging Het
Prrc2a G A 17: 35,153,620 R1682W probably damaging Het
Rb1 A G 14: 73,199,311 F838S probably damaging Het
Sec24c A G 14: 20,691,804 E769G probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tmem63c A T 12: 87,089,398 E796V probably benign Het
Tomm70a G A 16: 57,133,251 probably null Het
Tpcn1 G A 5: 120,539,214 T676I probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Ccdc171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Ccdc171 APN 4 83682324 nonsense probably null
IGL00707:Ccdc171 APN 4 83681155 missense probably benign 0.11
IGL00907:Ccdc171 APN 4 83864249 missense probably damaging 0.98
IGL01113:Ccdc171 APN 4 83661810 missense probably damaging 1.00
IGL01669:Ccdc171 APN 4 83681195 missense probably damaging 1.00
IGL01696:Ccdc171 APN 4 83655578 missense possibly damaging 0.66
IGL02006:Ccdc171 APN 4 83795242 missense possibly damaging 0.93
IGL02582:Ccdc171 APN 4 83743018 missense probably damaging 1.00
IGL03019:Ccdc171 APN 4 83795308 missense probably damaging 1.00
IGL03144:Ccdc171 APN 4 83818090 missense probably damaging 0.99
IGL03350:Ccdc171 APN 4 83681378 missense possibly damaging 0.67
IGL03377:Ccdc171 APN 4 83663517 missense probably damaging 1.00
PIT4131001:Ccdc171 UTSW 4 83661709
PIT4445001:Ccdc171 UTSW 4 83661747 missense probably damaging 1.00
R0219:Ccdc171 UTSW 4 83696441 splice site probably benign
R0284:Ccdc171 UTSW 4 83549738 missense possibly damaging 0.62
R0355:Ccdc171 UTSW 4 83635682 missense probably damaging 1.00
R1248:Ccdc171 UTSW 4 83681244 missense possibly damaging 0.46
R1278:Ccdc171 UTSW 4 83661858 missense possibly damaging 0.90
R1495:Ccdc171 UTSW 4 83681095 nonsense probably null
R1741:Ccdc171 UTSW 4 83620839 missense probably damaging 0.97
R1742:Ccdc171 UTSW 4 83681284 missense probably damaging 0.99
R1789:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R1801:Ccdc171 UTSW 4 83546895 missense probably benign 0.41
R4204:Ccdc171 UTSW 4 83681155 missense probably benign 0.11
R4245:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R4502:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4503:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4533:Ccdc171 UTSW 4 83657342 missense possibly damaging 0.66
R4589:Ccdc171 UTSW 4 83549618 missense probably benign 0.11
R4782:Ccdc171 UTSW 4 83681016 missense probably damaging 0.99
R4815:Ccdc171 UTSW 4 83795221 missense probably damaging 1.00
R4868:Ccdc171 UTSW 4 83694332 missense probably damaging 1.00
R4926:Ccdc171 UTSW 4 83558592 intron probably benign
R4937:Ccdc171 UTSW 4 83549639 missense probably damaging 1.00
R5120:Ccdc171 UTSW 4 83558526 intron probably benign
R5185:Ccdc171 UTSW 4 83663655 missense possibly damaging 0.84
R5243:Ccdc171 UTSW 4 83604107 missense probably damaging 1.00
R5484:Ccdc171 UTSW 4 83693962 missense probably benign 0.00
R5574:Ccdc171 UTSW 4 83693753 missense probably damaging 1.00
R6053:Ccdc171 UTSW 4 83795219 missense probably damaging 1.00
R6135:Ccdc171 UTSW 4 83554850 missense probably benign 0.12
R6140:Ccdc171 UTSW 4 83696317 nonsense probably null
R6339:Ccdc171 UTSW 4 83742997 missense probably damaging 1.00
R6452:Ccdc171 UTSW 4 83864290 missense probably damaging 1.00
R7111:Ccdc171 UTSW 4 83693761 missense probably benign 0.00
R7352:Ccdc171 UTSW 4 83818023 missense possibly damaging 0.82
R7390:Ccdc171 UTSW 4 83818067 missense probably damaging 1.00
R7626:Ccdc171 UTSW 4 83580775 nonsense probably null
R7686:Ccdc171 UTSW 4 83657319 missense unknown
R7705:Ccdc171 UTSW 4 83557956 missense possibly damaging 0.87
R8058:Ccdc171 UTSW 4 83580766 missense probably damaging 0.99
U24488:Ccdc171 UTSW 4 83661717 missense probably damaging 1.00
Z1176:Ccdc171 UTSW 4 83795230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCCATTGGTTAGGATCTTAGACTC -3'
(R):5'- CCTTGCTGAAGTACAACACAGC -3'

Sequencing Primer
(F):5'- CAGATTTCCCAAGAGAAATGG -3'
(R):5'- TGCTGAAGTACAACACAGCAGATATG -3'
Posted On2016-07-22