Incidental Mutation 'R5210:Iscu'
ID403088
Institutional Source Beutler Lab
Gene Symbol Iscu
Ensembl Gene ENSMUSG00000025825
Gene Nameiron-sulfur cluster assembly enzyme
Synonyms2310020H20Rik, Nifun
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5210 (G1)
Quality Score187
Status Validated
Chromosome5
Chromosomal Location113772748-113778288 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 113776973 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 182 (L182*)
Ref Sequence ENSEMBL: ENSMUSP00000107931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019118] [ENSMUST00000026937] [ENSMUST00000112311] [ENSMUST00000112312] [ENSMUST00000123616] [ENSMUST00000145592] [ENSMUST00000145778]
Predicted Effect probably benign
Transcript: ENSMUST00000019118
SMART Domains Protein: ENSMUSP00000019118
Gene: ENSMUSG00000018974

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
HAT 325 357 1.78e-4 SMART
HAT 360 392 7.83e-1 SMART
HAT 395 431 7.56e0 SMART
HAT 488 521 7.31e-1 SMART
coiled coil region 554 619 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
RRM 705 778 1.87e-14 SMART
RRM 802 874 3.2e-22 SMART
Pfam:LSM_int_assoc 877 937 3.1e-28 PFAM
Pfam:Lsm_interact 944 961 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026937
SMART Domains Protein: ENSMUSP00000026937
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 161 3.9e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112311
AA Change: L182*
SMART Domains Protein: ENSMUSP00000107930
Gene: ENSMUSG00000025825
AA Change: L182*

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 1.1e-51 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112312
AA Change: L182*
SMART Domains Protein: ENSMUSP00000107931
Gene: ENSMUSG00000025825
AA Change: L182*

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 3.4e-49 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123616
SMART Domains Protein: ENSMUSP00000117973
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134881
Predicted Effect probably benign
Transcript: ENSMUST00000145592
SMART Domains Protein: ENSMUSP00000123237
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
Pfam:NifU_N 32 136 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145778
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the iron-sulfur (Fe-S) cluster scaffold. Fe-S clusters are cofactors that play a role in the function of a diverse set of enzymes, including those that regulate metabolism, iron homeostasis, and oxidative stress response. Alternative splicing results in transcript variants encoding different protein isoforms that localize either to the cytosol or to the mitochondrion. Mutations in this gene have been found in patients with hereditary myopathy with lactic acidosis. A disease-associated mutation in an intron may activate a cryptic splice site, resulting in the production of a splice variant encoding a putatively non-functional protein. A pseudogene of this gene is present on chromosome 1. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,068,110 I399V probably benign Het
4932438A13Rik T C 3: 37,033,265 V710A possibly damaging Het
Ablim2 T A 5: 35,837,072 V342E probably benign Het
Adgre4 T A 17: 55,785,029 N96K probably damaging Het
Ccdc171 A G 4: 83,554,856 E174G probably damaging Het
Col11a1 T C 3: 114,153,157 F1026S probably damaging Het
Coro1c A G 5: 113,845,306 L387P probably damaging Het
Dsg1c C T 18: 20,274,701 T368I probably damaging Het
Exoc3l4 C A 12: 111,428,841 probably benign Het
Extl1 T C 4: 134,360,584 D453G probably benign Het
Gm21136 T C 7: 38,867,741 noncoding transcript Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Ifi208 T C 1: 173,683,265 S329P probably benign Het
Klra6 T A 6: 130,018,892 K168* probably null Het
Map3k5 T C 10: 20,024,901 S274P possibly damaging Het
Megf6 G T 4: 154,269,816 probably benign Het
Mmp12 T A 9: 7,349,729 Y53* probably null Het
Nucb2 T A 7: 116,528,987 Y278N probably damaging Het
Numa1 C A 7: 101,999,981 A973E probably benign Het
Olfr1369-ps1 A T 13: 21,116,052 Y120F probably damaging Het
Olfr1487 A G 19: 13,619,399 K79R probably damaging Het
Olfr830 T A 9: 18,875,807 L157Q probably damaging Het
Olfr99 C A 17: 37,279,933 K162N probably benign Het
Pcdhga3 C A 18: 37,675,910 T472K probably benign Het
Pclo A G 5: 14,713,450 D694G probably damaging Het
Plch1 A G 3: 63,699,778 probably null Het
Pou3f2 C T 4: 22,487,324 D270N probably damaging Het
Prrc2a G A 17: 35,153,620 R1682W probably damaging Het
Rb1 A G 14: 73,199,311 F838S probably damaging Het
Sec24c A G 14: 20,691,804 E769G probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tmem63c A T 12: 87,089,398 E796V probably benign Het
Tomm70a G A 16: 57,133,251 probably null Het
Tpcn1 G A 5: 120,539,214 T676I probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Iscu
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1974:Iscu UTSW 5 113777018 intron probably benign
R4972:Iscu UTSW 5 113776976 intron probably benign
R6805:Iscu UTSW 5 113775243 missense probably damaging 1.00
R7039:Iscu UTSW 5 113776772 missense possibly damaging 0.95
R7235:Iscu UTSW 5 113776882 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AAACTGTACTTTACCCCGCC -3'
(R):5'- ATACCGAGGGTGAGGCTATG -3'

Sequencing Primer
(F):5'- CACTTCAGGTGGAGGAAGCC -3'
(R):5'- GTGAGGCTATGGGCGAAG -3'
Posted On2016-07-22