Incidental Mutation 'R5210:Coro1c'
ID403089
Institutional Source Beutler Lab
Gene Symbol Coro1c
Ensembl Gene ENSMUSG00000004530
Gene Namecoronin, actin binding protein 1C
Synonymscoronin 3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5210 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location113842436-113908758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113845306 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 387 (L387P)
Ref Sequence ENSEMBL: ENSMUSP00000004646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004646] [ENSMUST00000164980]
Predicted Effect probably damaging
Transcript: ENSMUST00000004646
AA Change: L387P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004646
Gene: ENSMUSG00000004530
AA Change: L387P

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
WD40 119 159 1.09e-5 SMART
WD40 162 202 3.09e-5 SMART
DUF1900 256 390 4.5e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163995
Predicted Effect probably benign
Transcript: ENSMUST00000164980
SMART Domains Protein: ENSMUSP00000129314
Gene: ENSMUSG00000004530

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
Pfam:WD40 120 149 8e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172016
Meta Mutation Damage Score 0.9400 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,068,110 I399V probably benign Het
4932438A13Rik T C 3: 37,033,265 V710A possibly damaging Het
Ablim2 T A 5: 35,837,072 V342E probably benign Het
Adgre4 T A 17: 55,785,029 N96K probably damaging Het
Ccdc171 A G 4: 83,554,856 E174G probably damaging Het
Col11a1 T C 3: 114,153,157 F1026S probably damaging Het
Dsg1c C T 18: 20,274,701 T368I probably damaging Het
Exoc3l4 C A 12: 111,428,841 probably benign Het
Extl1 T C 4: 134,360,584 D453G probably benign Het
Gm21136 T C 7: 38,867,741 noncoding transcript Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Ifi208 T C 1: 173,683,265 S329P probably benign Het
Iscu T A 5: 113,776,973 L182* probably null Het
Klra6 T A 6: 130,018,892 K168* probably null Het
Map3k5 T C 10: 20,024,901 S274P possibly damaging Het
Megf6 G T 4: 154,269,816 probably benign Het
Mmp12 T A 9: 7,349,729 Y53* probably null Het
Nucb2 T A 7: 116,528,987 Y278N probably damaging Het
Numa1 C A 7: 101,999,981 A973E probably benign Het
Olfr1369-ps1 A T 13: 21,116,052 Y120F probably damaging Het
Olfr1487 A G 19: 13,619,399 K79R probably damaging Het
Olfr830 T A 9: 18,875,807 L157Q probably damaging Het
Olfr99 C A 17: 37,279,933 K162N probably benign Het
Pcdhga3 C A 18: 37,675,910 T472K probably benign Het
Pclo A G 5: 14,713,450 D694G probably damaging Het
Plch1 A G 3: 63,699,778 probably null Het
Pou3f2 C T 4: 22,487,324 D270N probably damaging Het
Prrc2a G A 17: 35,153,620 R1682W probably damaging Het
Rb1 A G 14: 73,199,311 F838S probably damaging Het
Sec24c A G 14: 20,691,804 E769G probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tmem63c A T 12: 87,089,398 E796V probably benign Het
Tomm70a G A 16: 57,133,251 probably null Het
Tpcn1 G A 5: 120,539,214 T676I probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Coro1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Coro1c APN 5 113849614 missense probably benign 0.07
IGL01138:Coro1c APN 5 113852161 splice site probably benign
IGL01474:Coro1c APN 5 113882155 splice site probably benign
IGL02075:Coro1c APN 5 113844393 missense probably damaging 1.00
IGL02106:Coro1c APN 5 113852273 missense probably benign 0.01
IGL02831:Coro1c APN 5 113844408 missense probably benign
R0254:Coro1c UTSW 5 113845252 missense probably benign 0.09
R0975:Coro1c UTSW 5 113882121 missense probably damaging 1.00
R1835:Coro1c UTSW 5 113848543 missense probably benign 0.10
R2944:Coro1c UTSW 5 113850800 missense probably damaging 1.00
R5354:Coro1c UTSW 5 113846165 missense possibly damaging 0.94
R5379:Coro1c UTSW 5 113845382 missense probably damaging 1.00
R5414:Coro1c UTSW 5 113848546 missense possibly damaging 0.55
R5869:Coro1c UTSW 5 113850846 intron probably benign
R5891:Coro1c UTSW 5 113850811 missense probably damaging 0.98
R7037:Coro1c UTSW 5 113845396 missense possibly damaging 0.60
R7116:Coro1c UTSW 5 113852206 nonsense probably null
R7536:Coro1c UTSW 5 113845289 missense probably damaging 1.00
R7855:Coro1c UTSW 5 113848597 missense probably benign 0.21
R7938:Coro1c UTSW 5 113848597 missense probably benign 0.21
R8043:Coro1c UTSW 5 113865759 splice site silent
R8078:Coro1c UTSW 5 113882103 missense probably damaging 0.98
X0018:Coro1c UTSW 5 113848594 missense probably benign 0.13
Z1088:Coro1c UTSW 5 113850649 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCATTACAAAAGCCAGTGC -3'
(R):5'- AAAGGTTGAGACACATCCCG -3'

Sequencing Primer
(F):5'- AGTGCTGGCTGGCCTAG -3'
(R):5'- GGAACGCTTGTCCTGCATC -3'
Posted On2016-07-22