Incidental Mutation 'R5210:Klra6'
ID403091
Institutional Source Beutler Lab
Gene Symbol Klra6
Ensembl Gene ENSMUSG00000061769
Gene Namekiller cell lectin-like receptor, subfamily A, member 6
SynonymsLy49F, Ly49f
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5210 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130013033-130026954 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 130018892 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 168 (K168*)
Ref Sequence ENSEMBL: ENSMUSP00000073700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074056]
Predicted Effect probably null
Transcript: ENSMUST00000074056
AA Change: K168*
SMART Domains Protein: ENSMUSP00000073700
Gene: ENSMUSG00000061769
AA Change: K168*

DomainStartEndE-ValueType
Blast:CLECT 73 123 3e-9 BLAST
CLECT 143 258 8.42e-18 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene belongs to the highly polymorphic family of C-type lectin-like Ly49 genes that are expressed in natural killer (NK) cells. The encoded protein is a homodimeric type II transmembrane receptor located at the cell surface and inhibits NK cell activation upon ligand binding. This gene is located in a cluster of several Klra paralogs on chromosome 6. Different strains of mice show variation in the number of paralogs, including strain specific duplications, deletions and pseudogene sequences. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,068,110 I399V probably benign Het
4932438A13Rik T C 3: 37,033,265 V710A possibly damaging Het
Ablim2 T A 5: 35,837,072 V342E probably benign Het
Adgre4 T A 17: 55,785,029 N96K probably damaging Het
Ccdc171 A G 4: 83,554,856 E174G probably damaging Het
Col11a1 T C 3: 114,153,157 F1026S probably damaging Het
Coro1c A G 5: 113,845,306 L387P probably damaging Het
Dsg1c C T 18: 20,274,701 T368I probably damaging Het
Exoc3l4 C A 12: 111,428,841 probably benign Het
Extl1 T C 4: 134,360,584 D453G probably benign Het
Gm21136 T C 7: 38,867,741 noncoding transcript Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Ifi208 T C 1: 173,683,265 S329P probably benign Het
Iscu T A 5: 113,776,973 L182* probably null Het
Map3k5 T C 10: 20,024,901 S274P possibly damaging Het
Megf6 G T 4: 154,269,816 probably benign Het
Mmp12 T A 9: 7,349,729 Y53* probably null Het
Nucb2 T A 7: 116,528,987 Y278N probably damaging Het
Numa1 C A 7: 101,999,981 A973E probably benign Het
Olfr1369-ps1 A T 13: 21,116,052 Y120F probably damaging Het
Olfr1487 A G 19: 13,619,399 K79R probably damaging Het
Olfr830 T A 9: 18,875,807 L157Q probably damaging Het
Olfr99 C A 17: 37,279,933 K162N probably benign Het
Pcdhga3 C A 18: 37,675,910 T472K probably benign Het
Pclo A G 5: 14,713,450 D694G probably damaging Het
Plch1 A G 3: 63,699,778 probably null Het
Pou3f2 C T 4: 22,487,324 D270N probably damaging Het
Prrc2a G A 17: 35,153,620 R1682W probably damaging Het
Rb1 A G 14: 73,199,311 F838S probably damaging Het
Sec24c A G 14: 20,691,804 E769G probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tmem63c A T 12: 87,089,398 E796V probably benign Het
Tomm70a G A 16: 57,133,251 probably null Het
Tpcn1 G A 5: 120,539,214 T676I probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Klra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Klra6 APN 6 130023700 missense possibly damaging 0.77
IGL02037:Klra6 APN 6 130013476 missense probably benign 0.02
IGL02319:Klra6 APN 6 130025214 missense probably damaging 0.98
IGL02427:Klra6 APN 6 130016717 missense possibly damaging 0.54
IGL02730:Klra6 APN 6 130022697 missense probably benign
IGL02822:Klra6 APN 6 130016710 nonsense probably null
R0485:Klra6 UTSW 6 130023638 missense probably benign 0.12
R0697:Klra6 UTSW 6 130016724 missense probably benign 0.18
R0731:Klra6 UTSW 6 130022705 missense probably damaging 1.00
R1081:Klra6 UTSW 6 130022625 missense probably damaging 0.96
R1708:Klra6 UTSW 6 130022714 nonsense probably null
R1749:Klra6 UTSW 6 130018952 missense probably damaging 1.00
R1842:Klra6 UTSW 6 130022610 missense probably benign 0.14
R1944:Klra6 UTSW 6 130018945 missense possibly damaging 0.92
R4214:Klra6 UTSW 6 130018922 missense probably benign 0.10
R5286:Klra6 UTSW 6 130018969 missense probably benign 0.02
R5418:Klra6 UTSW 6 130013430 missense probably damaging 0.96
R5764:Klra6 UTSW 6 130022729 missense possibly damaging 0.92
R6193:Klra6 UTSW 6 130018918 missense probably benign 0.12
R6536:Klra6 UTSW 6 130023719 missense probably benign 0.07
R6696:Klra6 UTSW 6 130016733 missense probably benign
R7021:Klra6 UTSW 6 130018858 missense possibly damaging 0.93
R7718:Klra6 UTSW 6 130013352 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCACAGTTTTGTTCACATTACAG -3'
(R):5'- CATAGATCATGAGTGTGCAGGG -3'

Sequencing Primer
(F):5'- AGTTTTGTTCACATTACAGGAAAATC -3'
(R):5'- TGAGAACTATGTGATTTTACCCCC -3'
Posted On2016-07-22