Incidental Mutation 'R5210:Sec24c'
ID403104
Institutional Source Beutler Lab
Gene Symbol Sec24c
Ensembl Gene ENSMUSG00000039367
Gene NameSec24 related gene family, member C (S. cerevisiae)
Synonyms2610204K03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5210 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20674308-20694852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20691804 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 769 (E769G)
Ref Sequence ENSEMBL: ENSMUSP00000153434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048016] [ENSMUST00000048657] [ENSMUST00000223751] [ENSMUST00000224791]
Predicted Effect probably benign
Transcript: ENSMUST00000048016
SMART Domains Protein: ENSMUSP00000040370
Gene: ENSMUSG00000039357

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_tran_10_N 70 178 2.6e-12 PFAM
Pfam:Glyco_transf_10 204 403 2.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048657
AA Change: E845G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045955
Gene: ENSMUSG00000039367
AA Change: E845G

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 424 462 8.2e-17 PFAM
Pfam:Sec23_trunk 501 745 7.3e-94 PFAM
Pfam:Sec23_BS 750 834 8e-20 PFAM
Pfam:Sec23_helical 847 948 2.3e-30 PFAM
Pfam:Gelsolin 963 1038 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183515
Predicted Effect probably damaging
Transcript: ENSMUST00000223751
AA Change: E769G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224722
Predicted Effect probably benign
Transcript: ENSMUST00000224791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225903
Meta Mutation Damage Score 0.8951 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display complete embryonic lethality between implantation and placentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,068,110 I399V probably benign Het
4932438A13Rik T C 3: 37,033,265 V710A possibly damaging Het
Ablim2 T A 5: 35,837,072 V342E probably benign Het
Adgre4 T A 17: 55,785,029 N96K probably damaging Het
Ccdc171 A G 4: 83,554,856 E174G probably damaging Het
Col11a1 T C 3: 114,153,157 F1026S probably damaging Het
Coro1c A G 5: 113,845,306 L387P probably damaging Het
Dsg1c C T 18: 20,274,701 T368I probably damaging Het
Exoc3l4 C A 12: 111,428,841 probably benign Het
Extl1 T C 4: 134,360,584 D453G probably benign Het
Gm21136 T C 7: 38,867,741 noncoding transcript Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Ifi208 T C 1: 173,683,265 S329P probably benign Het
Iscu T A 5: 113,776,973 L182* probably null Het
Klra6 T A 6: 130,018,892 K168* probably null Het
Map3k5 T C 10: 20,024,901 S274P possibly damaging Het
Megf6 G T 4: 154,269,816 probably benign Het
Mmp12 T A 9: 7,349,729 Y53* probably null Het
Nucb2 T A 7: 116,528,987 Y278N probably damaging Het
Numa1 C A 7: 101,999,981 A973E probably benign Het
Olfr1369-ps1 A T 13: 21,116,052 Y120F probably damaging Het
Olfr1487 A G 19: 13,619,399 K79R probably damaging Het
Olfr830 T A 9: 18,875,807 L157Q probably damaging Het
Olfr99 C A 17: 37,279,933 K162N probably benign Het
Pcdhga3 C A 18: 37,675,910 T472K probably benign Het
Pclo A G 5: 14,713,450 D694G probably damaging Het
Plch1 A G 3: 63,699,778 probably null Het
Pou3f2 C T 4: 22,487,324 D270N probably damaging Het
Prrc2a G A 17: 35,153,620 R1682W probably damaging Het
Rb1 A G 14: 73,199,311 F838S probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tmem63c A T 12: 87,089,398 E796V probably benign Het
Tomm70a G A 16: 57,133,251 probably null Het
Tpcn1 G A 5: 120,539,214 T676I probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Sec24c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sec24c APN 14 20693203 missense probably benign 0.03
IGL00574:Sec24c APN 14 20692395 missense probably damaging 0.99
IGL01514:Sec24c APN 14 20682771 missense possibly damaging 0.78
IGL01924:Sec24c APN 14 20689689 missense probably damaging 0.96
IGL02094:Sec24c APN 14 20688402 missense probably damaging 1.00
IGL02677:Sec24c APN 14 20689642 missense probably damaging 0.98
IGL02871:Sec24c APN 14 20692882 missense probably benign
Kahuna UTSW 14 20690773 missense probably damaging 0.99
R0010:Sec24c UTSW 14 20689261 unclassified probably benign
R0335:Sec24c UTSW 14 20688715 intron probably null
R0487:Sec24c UTSW 14 20683399 missense probably benign 0.01
R0609:Sec24c UTSW 14 20686948 missense probably damaging 1.00
R0626:Sec24c UTSW 14 20688437 missense probably damaging 1.00
R0734:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R0854:Sec24c UTSW 14 20689340 missense probably damaging 1.00
R1036:Sec24c UTSW 14 20692897 missense probably benign 0.14
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1702:Sec24c UTSW 14 20686573 missense probably null
R1765:Sec24c UTSW 14 20688854 unclassified probably benign
R1913:Sec24c UTSW 14 20689111 missense probably benign 0.06
R1920:Sec24c UTSW 14 20686887 missense probably damaging 0.99
R2084:Sec24c UTSW 14 20691279 missense probably benign 0.00
R3778:Sec24c UTSW 14 20683307 missense possibly damaging 0.63
R4383:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4385:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4659:Sec24c UTSW 14 20683144 missense probably damaging 0.99
R4798:Sec24c UTSW 14 20693712 missense probably damaging 1.00
R4872:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R5345:Sec24c UTSW 14 20693220 missense probably benign 0.00
R5610:Sec24c UTSW 14 20691825 missense probably damaging 1.00
R5614:Sec24c UTSW 14 20682738 missense possibly damaging 0.92
R5646:Sec24c UTSW 14 20679573 missense probably benign 0.01
R6460:Sec24c UTSW 14 20690800 missense probably damaging 1.00
R7181:Sec24c UTSW 14 20689333 missense probably damaging 1.00
RF010:Sec24c UTSW 14 20688715 intron probably null
Predicted Primers PCR Primer
(F):5'- AAGAGAATGGAGCCCTACTGC -3'
(R):5'- AGTCAGCAGTCATGGGTCTG -3'

Sequencing Primer
(F):5'- CAGAAGTTGGGGTATATTCAATGG -3'
(R):5'- GGGTCTGCTTCCCATCACATG -3'
Posted On2016-07-22