Incidental Mutation 'R5210:Slc45a2'
ID403107
Institutional Source Beutler Lab
Gene Symbol Slc45a2
Ensembl Gene ENSMUSG00000022243
Gene Namesolute carrier family 45, member 2
Synonymsblanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5210 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location11000721-11029233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11027785 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 480 (T480I)
Ref Sequence ENSEMBL: ENSMUSP00000112408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117100]
Predicted Effect probably damaging
Transcript: ENSMUST00000022851
AA Change: T480I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022851
Gene: ENSMUSG00000022243
AA Change: T480I

DomainStartEndE-ValueType
Pfam:MFS_2 34 262 2.4e-17 PFAM
Pfam:MFS_1 36 363 3e-13 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117100
AA Change: T480I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112408
Gene: ENSMUSG00000022243
AA Change: T480I

DomainStartEndE-ValueType
Pfam:MFS_2 1 457 2e-22 PFAM
Pfam:MFS_1 2 292 2.6e-12 PFAM
Meta Mutation Damage Score 0.1786 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,068,110 I399V probably benign Het
4932438A13Rik T C 3: 37,033,265 V710A possibly damaging Het
Ablim2 T A 5: 35,837,072 V342E probably benign Het
Adgre4 T A 17: 55,785,029 N96K probably damaging Het
Ccdc171 A G 4: 83,554,856 E174G probably damaging Het
Col11a1 T C 3: 114,153,157 F1026S probably damaging Het
Coro1c A G 5: 113,845,306 L387P probably damaging Het
Dsg1c C T 18: 20,274,701 T368I probably damaging Het
Exoc3l4 C A 12: 111,428,841 probably benign Het
Extl1 T C 4: 134,360,584 D453G probably benign Het
Gm21136 T C 7: 38,867,741 noncoding transcript Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Ifi208 T C 1: 173,683,265 S329P probably benign Het
Iscu T A 5: 113,776,973 L182* probably null Het
Klra6 T A 6: 130,018,892 K168* probably null Het
Map3k5 T C 10: 20,024,901 S274P possibly damaging Het
Megf6 G T 4: 154,269,816 probably benign Het
Mmp12 T A 9: 7,349,729 Y53* probably null Het
Nucb2 T A 7: 116,528,987 Y278N probably damaging Het
Numa1 C A 7: 101,999,981 A973E probably benign Het
Olfr1369-ps1 A T 13: 21,116,052 Y120F probably damaging Het
Olfr1487 A G 19: 13,619,399 K79R probably damaging Het
Olfr830 T A 9: 18,875,807 L157Q probably damaging Het
Olfr99 C A 17: 37,279,933 K162N probably benign Het
Pcdhga3 C A 18: 37,675,910 T472K probably benign Het
Pclo A G 5: 14,713,450 D694G probably damaging Het
Plch1 A G 3: 63,699,778 probably null Het
Pou3f2 C T 4: 22,487,324 D270N probably damaging Het
Prrc2a G A 17: 35,153,620 R1682W probably damaging Het
Rb1 A G 14: 73,199,311 F838S probably damaging Het
Sec24c A G 14: 20,691,804 E769G probably damaging Het
Tmem63c A T 12: 87,089,398 E796V probably benign Het
Tomm70a G A 16: 57,133,251 probably null Het
Tpcn1 G A 5: 120,539,214 T676I probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Slc45a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 synonymous probably benign
cheng UTSW 15 11025868 missense probably damaging 0.99
Draco2 UTSW 15 11000817 start codon destroyed probably benign 0.05
galak UTSW 15 11012667 missense probably benign
goku UTSW 15 11000855 nonsense probably null
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense possibly damaging 0.94
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 1.00
voldemort UTSW 15 unclassified
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site probably benign
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.01
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001130 missense possibly damaging 0.46
R7243:Slc45a2 UTSW 15 11023350 missense possibly damaging 0.94
R7839:Slc45a2 UTSW 15 11027749 missense probably benign
R7922:Slc45a2 UTSW 15 11027749 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGCTTTCTGGAGCTGTG -3'
(R):5'- AAAGAGCGGTTTCTTGCCATG -3'

Sequencing Primer
(F):5'- CTGTGAGAGCAGAGGCAAATAATTAC -3'
(R):5'- CCATGGGCTTCTTTTGTCTGAG -3'
Posted On2016-07-22