Incidental Mutation 'R5210:Dsg1c'
ID403112
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5210 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20274701 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 368 (T368I)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably damaging
Transcript: ENSMUST00000054128
AA Change: T368I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: T368I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,068,110 I399V probably benign Het
4932438A13Rik T C 3: 37,033,265 V710A possibly damaging Het
Ablim2 T A 5: 35,837,072 V342E probably benign Het
Adgre4 T A 17: 55,785,029 N96K probably damaging Het
Ccdc171 A G 4: 83,554,856 E174G probably damaging Het
Col11a1 T C 3: 114,153,157 F1026S probably damaging Het
Coro1c A G 5: 113,845,306 L387P probably damaging Het
Exoc3l4 C A 12: 111,428,841 probably benign Het
Extl1 T C 4: 134,360,584 D453G probably benign Het
Gm21136 T C 7: 38,867,741 noncoding transcript Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Ifi208 T C 1: 173,683,265 S329P probably benign Het
Iscu T A 5: 113,776,973 L182* probably null Het
Klra6 T A 6: 130,018,892 K168* probably null Het
Map3k5 T C 10: 20,024,901 S274P possibly damaging Het
Megf6 G T 4: 154,269,816 probably benign Het
Mmp12 T A 9: 7,349,729 Y53* probably null Het
Nucb2 T A 7: 116,528,987 Y278N probably damaging Het
Numa1 C A 7: 101,999,981 A973E probably benign Het
Olfr1369-ps1 A T 13: 21,116,052 Y120F probably damaging Het
Olfr1487 A G 19: 13,619,399 K79R probably damaging Het
Olfr830 T A 9: 18,875,807 L157Q probably damaging Het
Olfr99 C A 17: 37,279,933 K162N probably benign Het
Pcdhga3 C A 18: 37,675,910 T472K probably benign Het
Pclo A G 5: 14,713,450 D694G probably damaging Het
Plch1 A G 3: 63,699,778 probably null Het
Pou3f2 C T 4: 22,487,324 D270N probably damaging Het
Prrc2a G A 17: 35,153,620 R1682W probably damaging Het
Rb1 A G 14: 73,199,311 F838S probably damaging Het
Sec24c A G 14: 20,691,804 E769G probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tmem63c A T 12: 87,089,398 E796V probably benign Het
Tomm70a G A 16: 57,133,251 probably null Het
Tpcn1 G A 5: 120,539,214 T676I probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGGGTAATCACATGGATTTG -3'
(R):5'- AGTTTTCTGGACTGGCTCCC -3'

Sequencing Primer
(F):5'- TCACATGGATTTGTGTTCAACC -3'
(R):5'- CCCCTAAGGTTAACATTTTAGTTGG -3'
Posted On2016-07-22