Incidental Mutation 'R5211:Olfml3'
ID403122
Institutional Source Beutler Lab
Gene Symbol Olfml3
Ensembl Gene ENSMUSG00000027848
Gene Nameolfactomedin-like 3
Synonyms2810002E22Rik, HNOEL-iso, mONT3, ONT3
MMRRC Submission 042785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5211 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103722222-103738001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103737199 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 51 (H51Q)
Ref Sequence ENSEMBL: ENSMUSP00000029440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029440] [ENSMUST00000106852] [ENSMUST00000118317] [ENSMUST00000169286]
Predicted Effect probably benign
Transcript: ENSMUST00000029440
AA Change: H51Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029440
Gene: ENSMUSG00000027848
AA Change: H51Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Blast:OLF 65 133 8e-34 BLAST
OLF 137 401 9.22e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106852
Predicted Effect probably benign
Transcript: ENSMUST00000118317
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157042
Predicted Effect probably benign
Transcript: ENSMUST00000169286
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the olfactomedin-like gene family which also includes genes encoding noelin, tiarin, myocilin, amassin, optimedin, photomedin, and latrophilin. The encoded protein is a secreted extracellular matrix glycoprotein with a C-terminal olfactomedin domain that facilitates protein-protein interactions, cell adhesion, and intercellular interactions. It serves as both a scaffold protein that recruits bone morphogenetic protein 1 to its substrate chordin, and as a vascular tissue remodeler with pro-angiogenic properties. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,156,784 S181P probably benign Het
Adgrf5 A T 17: 43,422,620 T112S probably benign Het
Ascc2 T C 11: 4,673,399 V545A possibly damaging Het
Bmp2 A T 2: 133,554,630 S69C probably damaging Het
Btaf1 T A 19: 36,996,562 I1378K probably benign Het
Ces2b C T 8: 104,835,063 T263I possibly damaging Het
Cntn5 A T 9: 9,704,889 V635D possibly damaging Het
Dock6 T C 9: 21,820,352 E1218G probably benign Het
Eml6 T C 11: 29,854,145 I319V probably benign Het
Esd T C 14: 74,741,192 S65P probably damaging Het
Fam71f2 A T 6: 29,286,099 K128* probably null Het
Fstl3 A T 10: 79,780,178 Q166L probably benign Het
Gcn1l1 T A 5: 115,619,312 S2445T probably benign Het
Gfy C A 7: 45,177,858 L271F possibly damaging Het
Gjc2 A G 11: 59,177,458 V66A possibly damaging Het
Gm7271 C A 5: 76,516,403 T113K possibly damaging Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Itm2c T A 1: 85,906,528 V188E probably damaging Het
Jmjd1c C G 10: 67,232,016 S1766C probably damaging Het
Kcnn3 A G 3: 89,521,231 T255A probably benign Het
Kdm4d A C 9: 14,463,104 V486G probably benign Het
Krt18 T G 15: 102,031,453 I362S probably damaging Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Ly6f G A 15: 75,271,803 V120M probably damaging Het
Map3k4 A G 17: 12,232,434 V1524A possibly damaging Het
Mrgprh T C 17: 12,877,002 V43A probably benign Het
Mx2 A T 16: 97,547,433 M269L probably damaging Het
Myrfl C T 10: 116,798,630 V620I probably benign Het
Nlrp9b G A 7: 20,049,456 C908Y probably damaging Het
Nyap2 T A 1: 81,087,274 M1K probably null Het
Olfr745 C T 14: 50,643,253 T324I possibly damaging Het
Pcdhb1 G A 18: 37,266,651 V552I probably benign Het
Pm20d1 T A 1: 131,806,909 I353N possibly damaging Het
Sbk2 A G 7: 4,962,967 F73L possibly damaging Het
Scn10a A C 9: 119,661,232 L548R possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slmap T C 14: 26,482,962 Y68C probably damaging Het
Syde2 T C 3: 146,001,338 V611A probably benign Het
Sympk A G 7: 19,035,889 M164V probably benign Het
Syt17 T C 7: 118,442,403 S43G probably benign Het
Ubr1 T C 2: 120,893,170 T1303A possibly damaging Het
Vmn2r100 A G 17: 19,525,995 Y535C possibly damaging Het
Other mutations in Olfml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Olfml3 APN 3 103736982 unclassified probably null
IGL02130:Olfml3 APN 3 103736967 missense probably benign 0.20
R0133:Olfml3 UTSW 3 103737026 unclassified probably null
R0427:Olfml3 UTSW 3 103737014 missense probably benign 0.27
R2130:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R2131:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R2133:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R4688:Olfml3 UTSW 3 103732181 utr 3 prime probably benign
R5227:Olfml3 UTSW 3 103736421 missense possibly damaging 0.86
R6223:Olfml3 UTSW 3 103736460 missense probably damaging 1.00
R6493:Olfml3 UTSW 3 103736207 missense possibly damaging 0.61
R7128:Olfml3 UTSW 3 103737168 missense probably benign
R7191:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7224:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7298:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7299:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7300:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7355:Olfml3 UTSW 3 103736079 missense probably damaging 1.00
X0058:Olfml3 UTSW 3 103732116 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TCTACACAGGGCAAAGCTGG -3'
(R):5'- AAGGTGAAGGACTCTTATTCAGGC -3'

Sequencing Primer
(F):5'- CAAAGCTGGGTTCTGTGTCTCC -3'
(R):5'- AATTAAGCCAGGTTCCTCGG -3'
Posted On2016-07-22