Incidental Mutation 'R5211:Gcn1l1'
ID403127
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission 042785-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5211 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115619312 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2445 (S2445T)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably benign
Transcript: ENSMUST00000064454
AA Change: S2445T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: S2445T

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094427
SMART Domains Protein: ENSMUSP00000091994
Gene: ENSMUSG00000041638

DomainStartEndE-ValueType
Pfam:HEAT 42 72 5.8e-5 PFAM
low complexity region 310 318 N/A INTRINSIC
Pfam:HEAT_EZ 326 374 2.2e-5 PFAM
Blast:EZ_HEAT 403 439 1e-15 BLAST
Pfam:HEAT_EZ 703 757 1.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151030
AA Change: S1460T
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,156,784 S181P probably benign Het
Adgrf5 A T 17: 43,422,620 T112S probably benign Het
Ascc2 T C 11: 4,673,399 V545A possibly damaging Het
Bmp2 A T 2: 133,554,630 S69C probably damaging Het
Btaf1 T A 19: 36,996,562 I1378K probably benign Het
Ces2b C T 8: 104,835,063 T263I possibly damaging Het
Cntn5 A T 9: 9,704,889 V635D possibly damaging Het
Dock6 T C 9: 21,820,352 E1218G probably benign Het
Eml6 T C 11: 29,854,145 I319V probably benign Het
Esd T C 14: 74,741,192 S65P probably damaging Het
Fam71f2 A T 6: 29,286,099 K128* probably null Het
Fstl3 A T 10: 79,780,178 Q166L probably benign Het
Gfy C A 7: 45,177,858 L271F possibly damaging Het
Gjc2 A G 11: 59,177,458 V66A possibly damaging Het
Gm7271 C A 5: 76,516,403 T113K possibly damaging Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Itm2c T A 1: 85,906,528 V188E probably damaging Het
Jmjd1c C G 10: 67,232,016 S1766C probably damaging Het
Kcnn3 A G 3: 89,521,231 T255A probably benign Het
Kdm4d A C 9: 14,463,104 V486G probably benign Het
Krt18 T G 15: 102,031,453 I362S probably damaging Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Ly6f G A 15: 75,271,803 V120M probably damaging Het
Map3k4 A G 17: 12,232,434 V1524A possibly damaging Het
Mrgprh T C 17: 12,877,002 V43A probably benign Het
Mx2 A T 16: 97,547,433 M269L probably damaging Het
Myrfl C T 10: 116,798,630 V620I probably benign Het
Nlrp9b G A 7: 20,049,456 C908Y probably damaging Het
Nyap2 T A 1: 81,087,274 M1K probably null Het
Olfml3 A T 3: 103,737,199 H51Q probably benign Het
Olfr745 C T 14: 50,643,253 T324I possibly damaging Het
Pcdhb1 G A 18: 37,266,651 V552I probably benign Het
Pm20d1 T A 1: 131,806,909 I353N possibly damaging Het
Sbk2 A G 7: 4,962,967 F73L possibly damaging Het
Scn10a A C 9: 119,661,232 L548R possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slmap T C 14: 26,482,962 Y68C probably damaging Het
Syde2 T C 3: 146,001,338 V611A probably benign Het
Sympk A G 7: 19,035,889 M164V probably benign Het
Syt17 T C 7: 118,442,403 S43G probably benign Het
Ubr1 T C 2: 120,893,170 T1303A possibly damaging Het
Vmn2r100 A G 17: 19,525,995 Y535C possibly damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
R7027:Gcn1l1 UTSW 5 115616546 critical splice donor site probably null
R7038:Gcn1l1 UTSW 5 115611144 missense probably damaging 1.00
R7171:Gcn1l1 UTSW 5 115590293 missense probably benign 0.02
R7276:Gcn1l1 UTSW 5 115611060 missense probably damaging 1.00
R7456:Gcn1l1 UTSW 5 115604946 nonsense probably null
R7473:Gcn1l1 UTSW 5 115581804 missense probably benign 0.09
R7517:Gcn1l1 UTSW 5 115619696 missense probably benign 0.01
R7714:Gcn1l1 UTSW 5 115595300 missense probably damaging 0.97
R7752:Gcn1l1 UTSW 5 115615568 missense probably damaging 1.00
R7812:Gcn1l1 UTSW 5 115593692 missense possibly damaging 0.91
R8070:Gcn1l1 UTSW 5 115588998 missense probably benign 0.09
R8218:Gcn1l1 UTSW 5 115581529 missense probably benign 0.00
Z1177:Gcn1l1 UTSW 5 115614149 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGGGCAGCATCCAGTCTG -3'
(R):5'- GCTAAAGGCAAGGGTAGTCC -3'

Sequencing Primer
(F):5'- TAACGTGCTCGCGGTACTG -3'
(R):5'- AAGGGTAGTCCAGGGGCTC -3'
Posted On2016-07-22