Incidental Mutation 'R5211:Sbk2'
ID403129
Institutional Source Beutler Lab
Gene Symbol Sbk2
Ensembl Gene ENSMUSG00000030433
Gene NameSH3-binding domain kinase family, member 2
SynonymsLOC381836
MMRRC Submission 042785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5211 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4940512-4964406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4962967 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 73 (F73L)
Ref Sequence ENSEMBL: ENSMUSP00000138504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032598] [ENSMUST00000133272] [ENSMUST00000144863] [ENSMUST00000182214] [ENSMUST00000183170] [ENSMUST00000208109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032598
AA Change: F73L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032598
Gene: ENSMUSG00000030433
AA Change: F73L

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 296 2.8e-21 PFAM
Pfam:Pkinase 62 329 1.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133272
SMART Domains Protein: ENSMUSP00000120654
Gene: ENSMUSG00000085272

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 43 268 1.8e-17 PFAM
Pfam:Pkinase 43 304 1.7e-30 PFAM
Pfam:Kinase-like 130 262 1.6e-8 PFAM
low complexity region 309 321 N/A INTRINSIC
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144863
SMART Domains Protein: ENSMUSP00000122507
Gene: ENSMUSG00000085272

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 248 3.1e-17 PFAM
Pfam:Pkinase 24 284 5.6e-32 PFAM
Pfam:Kinase-like 111 237 2.5e-7 PFAM
low complexity region 290 302 N/A INTRINSIC
low complexity region 309 328 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182214
AA Change: F73L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138504
Gene: ENSMUSG00000030433
AA Change: F73L

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 296 3.7e-21 PFAM
Pfam:Pkinase 62 329 6.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182837
Predicted Effect probably benign
Transcript: ENSMUST00000183170
AA Change: F73L

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138187
Gene: ENSMUSG00000030433
AA Change: F73L

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 211 1.9e-18 PFAM
Pfam:Pkinase 62 212 3.2e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208109
AA Change: F73L

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,156,784 S181P probably benign Het
Adgrf5 A T 17: 43,422,620 T112S probably benign Het
Ascc2 T C 11: 4,673,399 V545A possibly damaging Het
Bmp2 A T 2: 133,554,630 S69C probably damaging Het
Btaf1 T A 19: 36,996,562 I1378K probably benign Het
Ces2b C T 8: 104,835,063 T263I possibly damaging Het
Cntn5 A T 9: 9,704,889 V635D possibly damaging Het
Dock6 T C 9: 21,820,352 E1218G probably benign Het
Eml6 T C 11: 29,854,145 I319V probably benign Het
Esd T C 14: 74,741,192 S65P probably damaging Het
Fam71f2 A T 6: 29,286,099 K128* probably null Het
Fstl3 A T 10: 79,780,178 Q166L probably benign Het
Gcn1l1 T A 5: 115,619,312 S2445T probably benign Het
Gfy C A 7: 45,177,858 L271F possibly damaging Het
Gjc2 A G 11: 59,177,458 V66A possibly damaging Het
Gm7271 C A 5: 76,516,403 T113K possibly damaging Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Itm2c T A 1: 85,906,528 V188E probably damaging Het
Jmjd1c C G 10: 67,232,016 S1766C probably damaging Het
Kcnn3 A G 3: 89,521,231 T255A probably benign Het
Kdm4d A C 9: 14,463,104 V486G probably benign Het
Krt18 T G 15: 102,031,453 I362S probably damaging Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Ly6f G A 15: 75,271,803 V120M probably damaging Het
Map3k4 A G 17: 12,232,434 V1524A possibly damaging Het
Mrgprh T C 17: 12,877,002 V43A probably benign Het
Mx2 A T 16: 97,547,433 M269L probably damaging Het
Myrfl C T 10: 116,798,630 V620I probably benign Het
Nlrp9b G A 7: 20,049,456 C908Y probably damaging Het
Nyap2 T A 1: 81,087,274 M1K probably null Het
Olfml3 A T 3: 103,737,199 H51Q probably benign Het
Olfr745 C T 14: 50,643,253 T324I possibly damaging Het
Pcdhb1 G A 18: 37,266,651 V552I probably benign Het
Pm20d1 T A 1: 131,806,909 I353N possibly damaging Het
Scn10a A C 9: 119,661,232 L548R possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slmap T C 14: 26,482,962 Y68C probably damaging Het
Syde2 T C 3: 146,001,338 V611A probably benign Het
Sympk A G 7: 19,035,889 M164V probably benign Het
Syt17 T C 7: 118,442,403 S43G probably benign Het
Ubr1 T C 2: 120,893,170 T1303A possibly damaging Het
Vmn2r100 A G 17: 19,525,995 Y535C possibly damaging Het
Other mutations in Sbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Sbk2 APN 7 4957529 missense probably damaging 1.00
IGL01595:Sbk2 APN 7 4957713 missense possibly damaging 0.86
IGL01688:Sbk2 APN 7 4957717 intron probably benign
IGL02901:Sbk2 APN 7 4957290 missense possibly damaging 0.66
IGL03392:Sbk2 APN 7 4957409 missense probably damaging 1.00
R1714:Sbk2 UTSW 7 4963122 missense probably benign 0.15
R2679:Sbk2 UTSW 7 4957120 unclassified probably null
R3158:Sbk2 UTSW 7 4957527 nonsense probably null
R4088:Sbk2 UTSW 7 4957628 missense probably damaging 1.00
R4709:Sbk2 UTSW 7 4957578 missense possibly damaging 0.79
R5906:Sbk2 UTSW 7 4957628 missense probably damaging 1.00
R6393:Sbk2 UTSW 7 4957622 missense probably damaging 1.00
R6967:Sbk2 UTSW 7 4964147 critical splice donor site probably null
R7045:Sbk2 UTSW 7 4958906 missense probably damaging 0.99
R7537:Sbk2 UTSW 7 4963149 missense probably benign 0.02
R7810:Sbk2 UTSW 7 4958939 missense probably damaging 1.00
R8058:Sbk2 UTSW 7 4957290 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCAAAGGAAAACTCTGGGGCTC -3'
(R):5'- GCCAATGGAAGTGTCAACTG -3'

Sequencing Primer
(F):5'- TCAGAGAGGTTAAAGCAACTCCCTG -3'
(R):5'- CCAATGGAAGTGTCAACTGTGGAG -3'
Posted On2016-07-22