Incidental Mutation 'R0416:Etv2'
ID40313
Institutional Source Beutler Lab
Gene Symbol Etv2
Ensembl Gene ENSMUSG00000006311
Gene Nameets variant 2
SynonymsEtsrp71
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0416 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30633616-30635852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30634633 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 225 (Y225C)
Ref Sequence ENSEMBL: ENSMUSP00000103782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108147]
Predicted Effect probably benign
Transcript: ENSMUST00000108147
AA Change: Y225C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103782
Gene: ENSMUSG00000006311
AA Change: Y225C

DomainStartEndE-ValueType
low complexity region 102 114 N/A INTRINSIC
ETS 233 318 4.77e-51 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for null alleles die during organogenesis and lack blood vessels. In addition, mice homozygous for one allele lack endocardial cells, while mice homozygous for another allele lack blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Etv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Etv2 APN 7 30633667 missense probably benign 0.13
R0144:Etv2 UTSW 7 30634883 missense probably benign 0.13
R6216:Etv2 UTSW 7 30634611 critical splice donor site probably null
R6812:Etv2 UTSW 7 30634001 nonsense probably null
R6972:Etv2 UTSW 7 30634742 missense probably benign 0.00
R6973:Etv2 UTSW 7 30634742 missense probably benign 0.00
R7180:Etv2 UTSW 7 30635649 missense probably damaging 1.00
R7236:Etv2 UTSW 7 30635030 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCCTAGAAAGTCAGTTCCGTCCTC -3'
(R):5'- TAAAATTCCCAAGGGTGCGGGAGAC -3'

Sequencing Primer
(F):5'- GTCAGTTCCGTCCTCTCACC -3'
(R):5'- TGGAGCTGTGCTTCACAGAC -3'
Posted On2013-05-23