Incidental Mutation 'R5211:Syt17'
ID 403133
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Name synaptotagmin XVII
Synonyms Bk
MMRRC Submission 042785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5211 (G1)
Quality Score 149
Status Not validated
Chromosome 7
Chromosomal Location 117979940-118047445 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118041626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 43 (S43G)
Ref Sequence ENSEMBL: ENSMUSP00000144987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000207034]
AlphaFold Q920M7
Predicted Effect probably benign
Transcript: ENSMUST00000081574
AA Change: S39G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420
AA Change: S39G

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203465
AA Change: S38G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000203485
AA Change: S43G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420
AA Change: S43G

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203796
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207650
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,394,233 (GRCm39) S181P probably benign Het
Adgrf5 A T 17: 43,733,511 (GRCm39) T112S probably benign Het
Ascc2 T C 11: 4,623,399 (GRCm39) V545A possibly damaging Het
Bmp2 A T 2: 133,396,550 (GRCm39) S69C probably damaging Het
Btaf1 T A 19: 36,973,962 (GRCm39) I1378K probably benign Het
Ces2b C T 8: 105,561,695 (GRCm39) T263I possibly damaging Het
Cntn5 A T 9: 9,704,894 (GRCm39) V635D possibly damaging Het
Dock6 T C 9: 21,731,648 (GRCm39) E1218G probably benign Het
Eml6 T C 11: 29,804,145 (GRCm39) I319V probably benign Het
Esd T C 14: 74,978,632 (GRCm39) S65P probably damaging Het
Exoc1l C A 5: 76,664,250 (GRCm39) T113K possibly damaging Het
Fstl3 A T 10: 79,616,012 (GRCm39) Q166L probably benign Het
Garin1a A T 6: 29,286,098 (GRCm39) K128* probably null Het
Gcn1 T A 5: 115,757,371 (GRCm39) S2445T probably benign Het
Gfy C A 7: 44,827,282 (GRCm39) L271F possibly damaging Het
Gjc2 A G 11: 59,068,284 (GRCm39) V66A possibly damaging Het
H3c4 G T 13: 23,760,015 (GRCm39) G14C possibly damaging Het
Itm2c T A 1: 85,834,249 (GRCm39) V188E probably damaging Het
Jmjd1c C G 10: 67,067,795 (GRCm39) S1766C probably damaging Het
Kcnn3 A G 3: 89,428,538 (GRCm39) T255A probably benign Het
Kdm4d A C 9: 14,374,400 (GRCm39) V486G probably benign Het
Krt18 T G 15: 101,939,888 (GRCm39) I362S probably damaging Het
Lrrc8d G A 5: 105,961,606 (GRCm39) R672Q probably damaging Het
Ly6f G A 15: 75,143,652 (GRCm39) V120M probably damaging Het
Map3k4 A G 17: 12,451,321 (GRCm39) V1524A possibly damaging Het
Mrgprh T C 17: 13,095,889 (GRCm39) V43A probably benign Het
Mx2 A T 16: 97,348,633 (GRCm39) M269L probably damaging Het
Myrfl C T 10: 116,634,535 (GRCm39) V620I probably benign Het
Nlrp9b G A 7: 19,783,381 (GRCm39) C908Y probably damaging Het
Nyap2 T A 1: 81,064,991 (GRCm39) M1K probably null Het
Olfml3 A T 3: 103,644,515 (GRCm39) H51Q probably benign Het
Or11h6 C T 14: 50,880,710 (GRCm39) T324I possibly damaging Het
Pcdhb1 G A 18: 37,399,704 (GRCm39) V552I probably benign Het
Pm20d1 T A 1: 131,734,647 (GRCm39) I353N possibly damaging Het
Sbk2 A G 7: 4,965,966 (GRCm39) F73L possibly damaging Het
Scn10a A C 9: 119,490,298 (GRCm39) L548R possibly damaging Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Slmap T C 14: 26,204,117 (GRCm39) Y68C probably damaging Het
Syde2 T C 3: 145,707,093 (GRCm39) V611A probably benign Het
Sympk A G 7: 18,769,814 (GRCm39) M164V probably benign Het
Ubr1 T C 2: 120,723,651 (GRCm39) T1303A possibly damaging Het
Vmn2r100 A G 17: 19,746,257 (GRCm39) Y535C possibly damaging Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118,033,513 (GRCm39) missense probably damaging 0.98
IGL01135:Syt17 APN 7 117,981,270 (GRCm39) missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118,007,389 (GRCm39) missense probably damaging 0.99
IGL01610:Syt17 APN 7 118,033,216 (GRCm39) missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118,009,176 (GRCm39) missense probably damaging 0.99
IGL02125:Syt17 APN 7 118,009,197 (GRCm39) missense probably benign 0.01
IGL02819:Syt17 APN 7 118,009,143 (GRCm39) splice site probably benign
H8562:Syt17 UTSW 7 118,007,292 (GRCm39) missense probably benign 0.01
R0127:Syt17 UTSW 7 118,009,164 (GRCm39) missense probably damaging 0.98
R0328:Syt17 UTSW 7 117,981,216 (GRCm39) missense probably benign 0.28
R1789:Syt17 UTSW 7 118,036,061 (GRCm39) missense probably benign 0.00
R1872:Syt17 UTSW 7 118,007,341 (GRCm39) missense probably benign 0.00
R1878:Syt17 UTSW 7 118,033,468 (GRCm39) missense probably benign 0.01
R1918:Syt17 UTSW 7 118,033,208 (GRCm39) missense possibly damaging 0.54
R2133:Syt17 UTSW 7 117,981,270 (GRCm39) missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118,033,180 (GRCm39) missense probably damaging 1.00
R4471:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4472:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4567:Syt17 UTSW 7 118,033,495 (GRCm39) missense probably benign 0.06
R5905:Syt17 UTSW 7 118,036,141 (GRCm39) missense probably benign 0.10
R6054:Syt17 UTSW 7 118,007,356 (GRCm39) missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118,033,513 (GRCm39) missense probably damaging 0.98
R6332:Syt17 UTSW 7 118,033,466 (GRCm39) missense probably benign 0.00
R7022:Syt17 UTSW 7 118,007,242 (GRCm39) missense probably benign 0.00
R7440:Syt17 UTSW 7 117,981,107 (GRCm39) missense probably damaging 1.00
R7610:Syt17 UTSW 7 118,033,682 (GRCm39) splice site probably null
R7845:Syt17 UTSW 7 118,009,194 (GRCm39) missense possibly damaging 0.79
R8294:Syt17 UTSW 7 118,009,228 (GRCm39) missense probably damaging 0.99
R8296:Syt17 UTSW 7 118,036,069 (GRCm39) missense probably damaging 0.97
R8429:Syt17 UTSW 7 118,033,564 (GRCm39) missense probably benign
R8949:Syt17 UTSW 7 118,033,054 (GRCm39) critical splice donor site probably null
R9278:Syt17 UTSW 7 118,033,480 (GRCm39) missense probably damaging 1.00
R9622:Syt17 UTSW 7 118,036,191 (GRCm39) missense probably benign
R9629:Syt17 UTSW 7 118,007,379 (GRCm39) missense probably damaging 0.96
Z1177:Syt17 UTSW 7 118,033,446 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCTTGGTGTGAGC -3'
(R):5'- TATCATGGGTGGGGCAATCC -3'

Sequencing Primer
(F):5'- CTTGCCCACAAATGAGGGG -3'
(R):5'- AATCTCTGACGTGCTGCT -3'
Posted On 2016-07-22