Incidental Mutation 'R5211:Syt17'
ID403133
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Namesynaptotagmin XVII
SynonymsBk
MMRRC Submission 042785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5211 (G1)
Quality Score149
Status Not validated
Chromosome7
Chromosomal Location118380717-118448222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118442403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 43 (S43G)
Ref Sequence ENSEMBL: ENSMUSP00000144987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000207034]
Predicted Effect probably benign
Transcript: ENSMUST00000081574
AA Change: S39G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420
AA Change: S39G

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203465
AA Change: S38G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000203485
AA Change: S43G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420
AA Change: S43G

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203796
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207650
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,156,784 S181P probably benign Het
Adgrf5 A T 17: 43,422,620 T112S probably benign Het
Ascc2 T C 11: 4,673,399 V545A possibly damaging Het
Bmp2 A T 2: 133,554,630 S69C probably damaging Het
Btaf1 T A 19: 36,996,562 I1378K probably benign Het
Ces2b C T 8: 104,835,063 T263I possibly damaging Het
Cntn5 A T 9: 9,704,889 V635D possibly damaging Het
Dock6 T C 9: 21,820,352 E1218G probably benign Het
Eml6 T C 11: 29,854,145 I319V probably benign Het
Esd T C 14: 74,741,192 S65P probably damaging Het
Fam71f2 A T 6: 29,286,099 K128* probably null Het
Fstl3 A T 10: 79,780,178 Q166L probably benign Het
Gcn1l1 T A 5: 115,619,312 S2445T probably benign Het
Gfy C A 7: 45,177,858 L271F possibly damaging Het
Gjc2 A G 11: 59,177,458 V66A possibly damaging Het
Gm7271 C A 5: 76,516,403 T113K possibly damaging Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Itm2c T A 1: 85,906,528 V188E probably damaging Het
Jmjd1c C G 10: 67,232,016 S1766C probably damaging Het
Kcnn3 A G 3: 89,521,231 T255A probably benign Het
Kdm4d A C 9: 14,463,104 V486G probably benign Het
Krt18 T G 15: 102,031,453 I362S probably damaging Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Ly6f G A 15: 75,271,803 V120M probably damaging Het
Map3k4 A G 17: 12,232,434 V1524A possibly damaging Het
Mrgprh T C 17: 12,877,002 V43A probably benign Het
Mx2 A T 16: 97,547,433 M269L probably damaging Het
Myrfl C T 10: 116,798,630 V620I probably benign Het
Nlrp9b G A 7: 20,049,456 C908Y probably damaging Het
Nyap2 T A 1: 81,087,274 M1K probably null Het
Olfml3 A T 3: 103,737,199 H51Q probably benign Het
Olfr745 C T 14: 50,643,253 T324I possibly damaging Het
Pcdhb1 G A 18: 37,266,651 V552I probably benign Het
Pm20d1 T A 1: 131,806,909 I353N possibly damaging Het
Sbk2 A G 7: 4,962,967 F73L possibly damaging Het
Scn10a A C 9: 119,661,232 L548R possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slmap T C 14: 26,482,962 Y68C probably damaging Het
Syde2 T C 3: 146,001,338 V611A probably benign Het
Sympk A G 7: 19,035,889 M164V probably benign Het
Ubr1 T C 2: 120,893,170 T1303A possibly damaging Het
Vmn2r100 A G 17: 19,525,995 Y535C possibly damaging Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118434290 missense probably damaging 0.98
IGL01135:Syt17 APN 7 118382047 missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118408166 missense probably damaging 0.99
IGL01610:Syt17 APN 7 118433993 missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118409953 missense probably damaging 0.99
IGL02125:Syt17 APN 7 118409974 missense probably benign 0.01
IGL02819:Syt17 APN 7 118409920 splice site probably benign
H8562:Syt17 UTSW 7 118408069 missense probably benign 0.01
R0127:Syt17 UTSW 7 118409941 missense probably damaging 0.98
R0328:Syt17 UTSW 7 118381993 missense probably benign 0.28
R1789:Syt17 UTSW 7 118436838 missense probably benign 0.00
R1872:Syt17 UTSW 7 118408118 missense probably benign 0.00
R1878:Syt17 UTSW 7 118434245 missense probably benign 0.01
R1918:Syt17 UTSW 7 118433985 missense possibly damaging 0.54
R2133:Syt17 UTSW 7 118382047 missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118433957 missense probably damaging 1.00
R4471:Syt17 UTSW 7 118436817 splice site probably null
R4472:Syt17 UTSW 7 118436817 splice site probably null
R4567:Syt17 UTSW 7 118434272 missense probably benign 0.06
R5905:Syt17 UTSW 7 118436918 missense probably benign 0.10
R6054:Syt17 UTSW 7 118408133 missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118434290 missense probably damaging 0.98
R6332:Syt17 UTSW 7 118434243 missense probably benign 0.00
R7022:Syt17 UTSW 7 118408019 missense probably benign 0.00
R7440:Syt17 UTSW 7 118381884 missense probably damaging 1.00
R7845:Syt17 UTSW 7 118409971 missense possibly damaging 0.79
R7928:Syt17 UTSW 7 118409971 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCTTGGTGTGAGC -3'
(R):5'- TATCATGGGTGGGGCAATCC -3'

Sequencing Primer
(F):5'- CTTGCCCACAAATGAGGGG -3'
(R):5'- AATCTCTGACGTGCTGCT -3'
Posted On2016-07-22