Incidental Mutation 'R5211:Kdm4d'
ID403136
Institutional Source Beutler Lab
Gene Symbol Kdm4d
Ensembl Gene ENSMUSG00000053914
Gene Namelysine (K)-specific demethylase 4D
SynonymsJmjd2d
MMRRC Submission 042785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5211 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location14462548-14500482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 14463104 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 486 (V486G)
Ref Sequence ENSEMBL: ENSMUSP00000061632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058796] [ENSMUST00000115647]
Predicted Effect probably benign
Transcript: ENSMUST00000058796
AA Change: V486G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000061632
Gene: ENSMUSG00000053914
AA Change: V486G

DomainStartEndE-ValueType
Pfam:JmjN 16 50 3.3e-15 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115647
SMART Domains Protein: ENSMUSP00000111311
Gene: ENSMUSG00000053914

DomainStartEndE-ValueType
Pfam:JmjN 16 50 1.1e-16 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of histone 3 methylation in spermatids, a transient increase in testes size, wider tubules, occasional male germ cell apoptosis, and decreased body weight. However, fertility is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,156,784 S181P probably benign Het
Adgrf5 A T 17: 43,422,620 T112S probably benign Het
Ascc2 T C 11: 4,673,399 V545A possibly damaging Het
Bmp2 A T 2: 133,554,630 S69C probably damaging Het
Btaf1 T A 19: 36,996,562 I1378K probably benign Het
Ces2b C T 8: 104,835,063 T263I possibly damaging Het
Cntn5 A T 9: 9,704,889 V635D possibly damaging Het
Dock6 T C 9: 21,820,352 E1218G probably benign Het
Eml6 T C 11: 29,854,145 I319V probably benign Het
Esd T C 14: 74,741,192 S65P probably damaging Het
Fam71f2 A T 6: 29,286,099 K128* probably null Het
Fstl3 A T 10: 79,780,178 Q166L probably benign Het
Gcn1l1 T A 5: 115,619,312 S2445T probably benign Het
Gfy C A 7: 45,177,858 L271F possibly damaging Het
Gjc2 A G 11: 59,177,458 V66A possibly damaging Het
Gm7271 C A 5: 76,516,403 T113K possibly damaging Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Itm2c T A 1: 85,906,528 V188E probably damaging Het
Jmjd1c C G 10: 67,232,016 S1766C probably damaging Het
Kcnn3 A G 3: 89,521,231 T255A probably benign Het
Krt18 T G 15: 102,031,453 I362S probably damaging Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Ly6f G A 15: 75,271,803 V120M probably damaging Het
Map3k4 A G 17: 12,232,434 V1524A possibly damaging Het
Mrgprh T C 17: 12,877,002 V43A probably benign Het
Mx2 A T 16: 97,547,433 M269L probably damaging Het
Myrfl C T 10: 116,798,630 V620I probably benign Het
Nlrp9b G A 7: 20,049,456 C908Y probably damaging Het
Nyap2 T A 1: 81,087,274 M1K probably null Het
Olfml3 A T 3: 103,737,199 H51Q probably benign Het
Olfr745 C T 14: 50,643,253 T324I possibly damaging Het
Pcdhb1 G A 18: 37,266,651 V552I probably benign Het
Pm20d1 T A 1: 131,806,909 I353N possibly damaging Het
Sbk2 A G 7: 4,962,967 F73L possibly damaging Het
Scn10a A C 9: 119,661,232 L548R possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slmap T C 14: 26,482,962 Y68C probably damaging Het
Syde2 T C 3: 146,001,338 V611A probably benign Het
Sympk A G 7: 19,035,889 M164V probably benign Het
Syt17 T C 7: 118,442,403 S43G probably benign Het
Ubr1 T C 2: 120,893,170 T1303A possibly damaging Het
Vmn2r100 A G 17: 19,525,995 Y535C possibly damaging Het
Other mutations in Kdm4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kdm4d APN 9 14464219 missense probably benign 0.10
IGL01114:Kdm4d APN 9 14464197 missense probably damaging 1.00
IGL01609:Kdm4d APN 9 14464418 missense probably damaging 0.99
IGL02342:Kdm4d APN 9 14463564 missense probably damaging 0.99
IGL02513:Kdm4d APN 9 14464554 missense probably benign 0.00
IGL03276:Kdm4d APN 9 14464542 missense probably benign 0.04
IGL03379:Kdm4d APN 9 14463843 missense probably damaging 1.00
R0220:Kdm4d UTSW 9 14463122 missense probably benign
R0755:Kdm4d UTSW 9 14464295 missense probably damaging 0.99
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1455:Kdm4d UTSW 9 14464395 missense probably damaging 0.98
R1552:Kdm4d UTSW 9 14464029 missense probably damaging 1.00
R1692:Kdm4d UTSW 9 14464511 missense probably benign 0.43
R1871:Kdm4d UTSW 9 14464383 missense probably damaging 1.00
R1892:Kdm4d UTSW 9 14464317 missense probably benign 0.14
R4792:Kdm4d UTSW 9 14463390 missense probably benign
R5113:Kdm4d UTSW 9 14464113 missense probably damaging 1.00
R5352:Kdm4d UTSW 9 14464358 missense probably damaging 1.00
R6692:Kdm4d UTSW 9 14463065 missense probably benign
R7014:Kdm4d UTSW 9 14464179 missense probably damaging 0.99
R7198:Kdm4d UTSW 9 14464020 missense probably damaging 1.00
R7260:Kdm4d UTSW 9 14463158 missense probably benign 0.05
R8116:Kdm4d UTSW 9 14463941 missense probably damaging 1.00
R8134:Kdm4d UTSW 9 14463236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGACCAGGAGCTCTCTC -3'
(R):5'- TCCAGAAGTCTGACTCAGCC -3'

Sequencing Primer
(F):5'- AGCTCTCTCAGGTATGGCCAATG -3'
(R):5'- CAGAAGTCTGACTCAGCCAGAGC -3'
Posted On2016-07-22