Incidental Mutation 'R5211:Eml6'
ID403142
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 042785-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R5211 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29854145 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 319 (I319V)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
AA Change: I319V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: I319V

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157510
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,156,784 S181P probably benign Het
Adgrf5 A T 17: 43,422,620 T112S probably benign Het
Ascc2 T C 11: 4,673,399 V545A possibly damaging Het
Bmp2 A T 2: 133,554,630 S69C probably damaging Het
Btaf1 T A 19: 36,996,562 I1378K probably benign Het
Ces2b C T 8: 104,835,063 T263I possibly damaging Het
Cntn5 A T 9: 9,704,889 V635D possibly damaging Het
Dock6 T C 9: 21,820,352 E1218G probably benign Het
Esd T C 14: 74,741,192 S65P probably damaging Het
Fam71f2 A T 6: 29,286,099 K128* probably null Het
Fstl3 A T 10: 79,780,178 Q166L probably benign Het
Gcn1l1 T A 5: 115,619,312 S2445T probably benign Het
Gfy C A 7: 45,177,858 L271F possibly damaging Het
Gjc2 A G 11: 59,177,458 V66A possibly damaging Het
Gm7271 C A 5: 76,516,403 T113K possibly damaging Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Itm2c T A 1: 85,906,528 V188E probably damaging Het
Jmjd1c C G 10: 67,232,016 S1766C probably damaging Het
Kcnn3 A G 3: 89,521,231 T255A probably benign Het
Kdm4d A C 9: 14,463,104 V486G probably benign Het
Krt18 T G 15: 102,031,453 I362S probably damaging Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Ly6f G A 15: 75,271,803 V120M probably damaging Het
Map3k4 A G 17: 12,232,434 V1524A possibly damaging Het
Mrgprh T C 17: 12,877,002 V43A probably benign Het
Mx2 A T 16: 97,547,433 M269L probably damaging Het
Myrfl C T 10: 116,798,630 V620I probably benign Het
Nlrp9b G A 7: 20,049,456 C908Y probably damaging Het
Nyap2 T A 1: 81,087,274 M1K probably null Het
Olfml3 A T 3: 103,737,199 H51Q probably benign Het
Olfr745 C T 14: 50,643,253 T324I possibly damaging Het
Pcdhb1 G A 18: 37,266,651 V552I probably benign Het
Pm20d1 T A 1: 131,806,909 I353N possibly damaging Het
Sbk2 A G 7: 4,962,967 F73L possibly damaging Het
Scn10a A C 9: 119,661,232 L548R possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slmap T C 14: 26,482,962 Y68C probably damaging Het
Syde2 T C 3: 146,001,338 V611A probably benign Het
Sympk A G 7: 19,035,889 M164V probably benign Het
Syt17 T C 7: 118,442,403 S43G probably benign Het
Ubr1 T C 2: 120,893,170 T1303A possibly damaging Het
Vmn2r100 A G 17: 19,525,995 Y535C possibly damaging Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
R7615:Eml6 UTSW 11 29802501 missense possibly damaging 0.49
R7692:Eml6 UTSW 11 29753085 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGCCTATGCTGCAGTTTATCC -3'
(R):5'- TGGGCCTTACACAGATGTATG -3'

Sequencing Primer
(F):5'- TGCTGCAGTTTATCCTTAAATCAC -3'
(R):5'- CTAGCTTGCTGAAAGGTGCATAAC -3'
Posted On2016-07-22