Incidental Mutation 'R0416:Polg'
ID40317
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Namepolymerase (DNA directed), gamma
SynonymsPol gamma, Polga, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0416 (G1)
Quality Score203
Status Validated
Chromosome7
Chromosomal Location79446231-79466362 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 79452240 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000132091] [ENSMUST00000139290] [ENSMUST00000149444] [ENSMUST00000201907]
Predicted Effect probably benign
Transcript: ENSMUST00000036865
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073889
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127734
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139290
SMART Domains Protein: ENSMUSP00000144035
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 1 69 2e-41 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139597
Predicted Effect probably benign
Transcript: ENSMUST00000139668
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139795
Predicted Effect probably benign
Transcript: ENSMUST00000143672
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145154
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154403
Predicted Effect probably benign
Transcript: ENSMUST00000201030
Predicted Effect probably benign
Transcript: ENSMUST00000201662
Predicted Effect probably benign
Transcript: ENSMUST00000201907
SMART Domains Protein: ENSMUSP00000144084
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
Blast:POLAc 1 49 4e-24 BLAST
PDB:3IKM|D 1 50 6e-24 PDB
SCOP:d1t7pa2 21 49 3e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79451925 missense probably damaging 1.00
IGL00970:Polg APN 7 79451745 missense probably benign 0.01
IGL01883:Polg APN 7 79458318 missense probably damaging 1.00
IGL02124:Polg APN 7 79459737 missense probably damaging 1.00
IGL02127:Polg APN 7 79458167 unclassified probably benign
IGL02820:Polg APN 7 79459771 missense possibly damaging 0.92
IGL03075:Polg APN 7 79451912 missense probably damaging 1.00
IGL03180:Polg APN 7 79451853 splice site probably benign
IGL03198:Polg APN 7 79451722 missense probably damaging 1.00
IGL03222:Polg APN 7 79454656 missense probably damaging 0.98
R0030:Polg UTSW 7 79452128 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0522:Polg UTSW 7 79460151 splice site probably benign
R0638:Polg UTSW 7 79460148 splice site probably benign
R1263:Polg UTSW 7 79459786 missense probably benign
R1831:Polg UTSW 7 79459770 missense probably benign 0.41
R1873:Polg UTSW 7 79456493 missense probably benign 0.04
R1906:Polg UTSW 7 79460322 missense probably damaging 1.00
R1997:Polg UTSW 7 79459231 missense probably damaging 1.00
R2127:Polg UTSW 7 79464928 missense probably damaging 1.00
R2155:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2156:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2173:Polg UTSW 7 79455593 missense probably damaging 0.99
R3720:Polg UTSW 7 79456791 nonsense probably null
R4082:Polg UTSW 7 79464828 missense probably damaging 1.00
R4127:Polg UTSW 7 79455537 missense probably damaging 1.00
R4510:Polg UTSW 7 79455522 missense probably benign 0.01
R4511:Polg UTSW 7 79455522 missense probably benign 0.01
R4571:Polg UTSW 7 79460379 missense probably damaging 1.00
R4888:Polg UTSW 7 79464605 missense probably damaging 1.00
R5008:Polg UTSW 7 79460074 missense probably damaging 1.00
R5095:Polg UTSW 7 79460300 missense possibly damaging 0.92
R5121:Polg UTSW 7 79464605 missense probably damaging 1.00
R5139:Polg UTSW 7 79450025 missense probably damaging 1.00
R5213:Polg UTSW 7 79454098 missense probably damaging 1.00
R5285:Polg UTSW 7 79465225 utr 5 prime probably benign
R5498:Polg UTSW 7 79454670 missense probably damaging 1.00
R5714:Polg UTSW 7 79451991 missense possibly damaging 0.53
R5940:Polg UTSW 7 79454071 missense possibly damaging 0.95
R6146:Polg UTSW 7 79450512 missense probably benign 0.02
R6754:Polg UTSW 7 79459836 missense probably damaging 1.00
R6791:Polg UTSW 7 79460109 missense probably benign 0.25
R6829:Polg UTSW 7 79460109 missense probably benign 0.25
R6913:Polg UTSW 7 79460657 missense probably damaging 0.97
R7644:Polg UTSW 7 79451668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCATGCTCGTTCAGAGGCTAC -3'
(R):5'- AATAGGTGACATGGTCTGGAGCCC -3'

Sequencing Primer
(F):5'- CTTTGGGACCCCACAAGTC -3'
(R):5'- GGTCCCTTGAACTAATAAAAGGCTG -3'
Posted On2013-05-23