Mutagenetix > Incidental Mutations

Incidental Mutation 'R5212:Clip1'

403177

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Clip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50

MMRRC Submission

042786-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5212 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123577795-123684618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 123630681 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 618 (R618S)

Ref Sequence

ENSEMBL: ENSMUSP00000107192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]

Predicted Effect

probably benign
Transcript: ENSMUST00000031382
AA Change: R664S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: R664S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000063905
AA Change: R653S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: R653S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111561
AA Change: R653S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: R653S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111564
AA Change: R618S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: R618S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111566
AA Change: R618S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: R618S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122603

Predicted Effect

unknown
Transcript: ENSMUST00000137363
AA Change: R405S

SMART Domains

Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: R405S

Domain	Start	End	E-Value	Type
CAP_GLY	2	31	2.59e0	SMART
low complexity region	39	57	N/A	INTRINSIC
low complexity region	58	84	N/A	INTRINSIC
coiled coil region	101	276	N/A	INTRINSIC
coiled coil region	322	361	N/A	INTRINSIC
coiled coil region	393	980	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1004	1021	4.2e-9	PFAM
ZnF_C2HC	1046	1062	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144121

SMART Domains

Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
CAP_GLY	37	102	1.05e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149410
AA Change: R587S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550
AA Change: R587S

Domain	Start	End	E-Value	Type
low complexity region	26	32	N/A	INTRINSIC
CAP_GLY	60	125	1.05e-31	SMART
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	334	458	N/A	INTRINSIC
coiled coil region	504	543	N/A	INTRINSIC
coiled coil region	575	827	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199018

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,065,850	S267T	possibly damaging	Het
Abca9	T	C	11: 110,107,226	D1514G	probably benign	Het
Adamtsl4	T	A	3: 95,677,670	D896V	probably damaging	Het
Amer2	A	G	14: 60,379,820	Y362C	probably damaging	Het
Arglu1	T	A	8: 8,683,843	R158W	probably damaging	Het
Arhgef7	A	G	8: 11,728,388	E46G	probably benign	Het
Atg2b	A	G	12: 105,646,796	V1172A	probably benign	Het
Bhlhe23	T	A	2: 180,776,093	K217N	probably damaging	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
Ccp110	C	T	7: 118,729,696	A845V	probably damaging	Het
Cd63	A	G	10: 128,911,853	Y105C	probably damaging	Het
Cdk11b	T	C	4: 155,638,615		probably null	Het
Crybg1	A	T	10: 43,967,743	F1731L	possibly damaging	Het
Dock1	A	C	7: 134,789,194	K728Q	possibly damaging	Het
Emc2	A	G	15: 43,510,844	E180G	probably damaging	Het
F13b	A	T	1: 139,512,987	I394F	probably benign	Het
Fnta	A	G	8: 26,009,707	I155T	probably benign	Het
Fshr	T	A	17: 88,986,256	E331D	probably benign	Het
Fshr	T	A	17: 88,986,257	E331V	probably benign	Het
Gas2l1	A	T	11: 5,061,108	C574S	probably benign	Het
Ggnbp2	T	A	11: 84,854,021		probably benign	Het
Gm3371	A	C	14: 44,403,654		probably benign	Het
Gm7489	T	A	15: 53,885,620		probably benign	Het
Hand1	A	C	11: 57,831,447	F114V	probably damaging	Het
Itga4	A	C	2: 79,280,595	H259P	probably damaging	Het
Jakmip1	A	T	5: 37,104,901	H183L	probably benign	Het
Kif1bp	A	T	10: 62,563,129		probably benign	Het
Krt8	G	T	15: 101,997,967	A369D	possibly damaging	Het
Krt82	T	C	15: 101,545,049	S301G	probably damaging	Het
Lig3	A	G	11: 82,787,678	T248A	probably benign	Het
Madcam1	C	G	10: 79,668,345	T255S	probably benign	Het
Med20	T	C	17: 47,618,850	Y71H	probably benign	Het
Mtss1l	A	G	8: 110,729,218	I107V	probably damaging	Het
Nans	T	C	4: 46,502,547	F328S	possibly damaging	Het
Ncbp3	A	G	11: 73,053,547		probably benign	Het
Nek8	T	C	11: 78,172,516	M1V	probably null	Het
Nufip1	A	T	14: 76,133,098	N413I	possibly damaging	Het
Pbx3	T	C	2: 34,288,781		probably benign	Het
Plppr3	C	T	10: 79,862,445	G419R	probably benign	Het
Rfx1	G	T	8: 84,066,592		probably benign	Het
Rnpepl1	C	T	1: 92,911,323	A68V	probably benign	Het
Rsbn1l	A	T	5: 20,896,214	M776K	probably benign	Het
Setd7	A	T	3: 51,542,817	Y63N	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Snap47	T	C	11: 59,428,352	E320G	probably damaging	Het
Spaca6	C	A	17: 17,838,394	P68Q	probably benign	Het
Tdrd3	G	C	14: 87,506,215	R527P	probably damaging	Het
Tmprss2	G	T	16: 97,576,292	Q202K	probably benign	Het
Tmprss6	A	G	15: 78,446,260	V69A	probably damaging	Het
Trav6-1	A	T	14: 52,638,704	Q27L	probably benign	Het
Ttn	T	C	2: 76,789,601	I15908V	probably benign	Het
Ttn	T	A	2: 76,797,675	D12931V	probably damaging	Het
Ttn	C	T	2: 76,901,613		probably benign	Het
Ush2a	T	A	1: 188,444,705		probably null	Het
Wls	A	G	3: 159,873,008	N69S	probably benign	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123603654	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123630804	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123579379	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123617496	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123583549	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123603666	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123623207	splice site	probably benign
IGL02120:Clip1	APN	5	123647883	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123617700	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123621794	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123621856	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123653570	nonsense	probably null
IGL03365:Clip1	APN	5	123583586	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123631123	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123630675	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123617332	splice site	probably benign
R0401:Clip1	UTSW	5	123653789	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123640531	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R1116:Clip1	UTSW	5	123579491	missense	probably damaging	0.99
R1182:Clip1	UTSW	5	123647865	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123630403	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123630370	missense	probably benign
R1889:Clip1	UTSW	5	123653496	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123623218	missense	possibly damaging	0.79
R2406:Clip1	UTSW	5	123603660	missense	probably damaging	1.00
R3545:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123590834	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123617829	unclassified	probably benign
R4660:Clip1	UTSW	5	123579374	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123631023	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123583601	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123630345	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123654003	nonsense	probably null
R5014:Clip1	UTSW	5	123617730	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123630707	missense	probably benign	0.05
R5238:Clip1	UTSW	5	123647883	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123613084	unclassified	probably benign
R5372:Clip1	UTSW	5	123630240	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123613303	unclassified	probably benign
R5734:Clip1	UTSW	5	123615154	unclassified	probably benign
R5757:Clip1	UTSW	5	123627397	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123615089	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123613541	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123613834	unclassified	probably benign
R6183:Clip1	UTSW	5	123642604	missense	probably damaging	1.00
R6377:Clip1	UTSW	5	123603654	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123641785	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123640549	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123614764	unclassified	probably benign
R7015:Clip1	UTSW	5	123613612	unclassified	probably benign
R7094:Clip1	UTSW	5	123623270	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123653610	missense	probably benign
R7222:Clip1	UTSW	5	123611841	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123611859	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123613265	missense
R7249:Clip1	UTSW	5	123603600	missense	probably damaging	1.00
R7283:Clip1	UTSW	5	123613794	missense
R7295:Clip1	UTSW	5	123627356	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123653633	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123640546	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123617384	missense	probably benign	0.00
R7516:Clip1	UTSW	5	123583385	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123614279	missense
R7831:Clip1	UTSW	5	123613279	missense
R7897:Clip1	UTSW	5	123622798	missense	probably benign
R8155:Clip1	UTSW	5	123613636	missense
R8157:Clip1	UTSW	5	123630719	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123647918	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123642564	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123655945	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123614707	unclassified	probably benign
R8511:Clip1	UTSW	5	123653906	missense	possibly damaging	0.50
Z1177:Clip1	UTSW	5	123617350	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACTAGGTGCTGGTCTTCTG -3'
(R):5'- ACGGCCACTGAGAAGCTTTC -3'

Sequencing Primer
(F):5'- GGTCTTCTGCACTGTCCAG -3'
(R):5'- TTTCCAAAGAGAACGAGTCCCTGAG -3'

Posted On

2016-07-22