Incidental Mutation 'R5212:Fnta'
ID403183
Institutional Source Beutler Lab
Gene Symbol Fnta
Ensembl Gene ENSMUSG00000015994
Gene Namefarnesyltransferase, CAAX box, alpha
SynonymsFTA
MMRRC Submission 042786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5212 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25998722-26015650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26009707 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 155 (I155T)
Ref Sequence ENSEMBL: ENSMUSP00000016138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016138]
PDB Structure
Crystal structure of FTase(ALPHA-subunit; BETA-subunit DELTA C10) in complex with BMS3 and lipid substrate FPP [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000016138
AA Change: I155T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000016138
Gene: ENSMUSG00000015994
AA Change: I155T

DomainStartEndE-ValueType
low complexity region 11 48 N/A INTRINSIC
Pfam:PPTA 116 143 4.6e-11 PFAM
Pfam:PPTA 151 178 9.2e-14 PFAM
Pfam:PPTA 185 212 3.9e-15 PFAM
Pfam:PPTA 219 246 8.1e-11 PFAM
Pfam:PPTA 259 285 4.7e-9 PFAM
low complexity region 293 304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209664
Meta Mutation Damage Score 0.8044 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,065,850 S267T possibly damaging Het
Abca9 T C 11: 110,107,226 D1514G probably benign Het
Adamtsl4 T A 3: 95,677,670 D896V probably damaging Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Arglu1 T A 8: 8,683,843 R158W probably damaging Het
Arhgef7 A G 8: 11,728,388 E46G probably benign Het
Atg2b A G 12: 105,646,796 V1172A probably benign Het
Bhlhe23 T A 2: 180,776,093 K217N probably damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Ccp110 C T 7: 118,729,696 A845V probably damaging Het
Cd63 A G 10: 128,911,853 Y105C probably damaging Het
Cdk11b T C 4: 155,638,615 probably null Het
Clip1 T A 5: 123,630,681 R618S probably benign Het
Crybg1 A T 10: 43,967,743 F1731L possibly damaging Het
Dock1 A C 7: 134,789,194 K728Q possibly damaging Het
Emc2 A G 15: 43,510,844 E180G probably damaging Het
F13b A T 1: 139,512,987 I394F probably benign Het
Fshr T A 17: 88,986,256 E331D probably benign Het
Fshr T A 17: 88,986,257 E331V probably benign Het
Gas2l1 A T 11: 5,061,108 C574S probably benign Het
Ggnbp2 T A 11: 84,854,021 probably benign Het
Gm3371 A C 14: 44,403,654 probably benign Het
Gm7489 T A 15: 53,885,620 probably benign Het
Hand1 A C 11: 57,831,447 F114V probably damaging Het
Itga4 A C 2: 79,280,595 H259P probably damaging Het
Jakmip1 A T 5: 37,104,901 H183L probably benign Het
Kif1bp A T 10: 62,563,129 probably benign Het
Krt8 G T 15: 101,997,967 A369D possibly damaging Het
Krt82 T C 15: 101,545,049 S301G probably damaging Het
Lig3 A G 11: 82,787,678 T248A probably benign Het
Madcam1 C G 10: 79,668,345 T255S probably benign Het
Med20 T C 17: 47,618,850 Y71H probably benign Het
Mtss1l A G 8: 110,729,218 I107V probably damaging Het
Nans T C 4: 46,502,547 F328S possibly damaging Het
Ncbp3 A G 11: 73,053,547 probably benign Het
Nek8 T C 11: 78,172,516 M1V probably null Het
Nufip1 A T 14: 76,133,098 N413I possibly damaging Het
Pbx3 T C 2: 34,288,781 probably benign Het
Plppr3 C T 10: 79,862,445 G419R probably benign Het
Rfx1 G T 8: 84,066,592 probably benign Het
Rnpepl1 C T 1: 92,911,323 A68V probably benign Het
Rsbn1l A T 5: 20,896,214 M776K probably benign Het
Setd7 A T 3: 51,542,817 Y63N probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snap47 T C 11: 59,428,352 E320G probably damaging Het
Spaca6 C A 17: 17,838,394 P68Q probably benign Het
Tdrd3 G C 14: 87,506,215 R527P probably damaging Het
Tmprss2 G T 16: 97,576,292 Q202K probably benign Het
Tmprss6 A G 15: 78,446,260 V69A probably damaging Het
Trav6-1 A T 14: 52,638,704 Q27L probably benign Het
Ttn T C 2: 76,789,601 I15908V probably benign Het
Ttn T A 2: 76,797,675 D12931V probably damaging Het
Ttn C T 2: 76,901,613 probably benign Het
Ush2a T A 1: 188,444,705 probably null Het
Wls A G 3: 159,873,008 N69S probably benign Het
Other mutations in Fnta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fnta APN 8 26007201 nonsense probably null
IGL01508:Fnta APN 8 26007266 missense probably damaging 1.00
R0455:Fnta UTSW 8 26001028 missense probably benign 0.00
R1462:Fnta UTSW 8 25999571 splice site probably null
R1462:Fnta UTSW 8 25999571 splice site probably null
R1772:Fnta UTSW 8 26000966 splice site probably benign
R2095:Fnta UTSW 8 25999879 nonsense probably null
R2174:Fnta UTSW 8 26013470 missense possibly damaging 0.95
R5193:Fnta UTSW 8 26011218 splice site probably null
R5557:Fnta UTSW 8 25999536 missense probably damaging 1.00
R5756:Fnta UTSW 8 26009707 missense possibly damaging 0.94
R6467:Fnta UTSW 8 26007313 nonsense probably null
R7127:Fnta UTSW 8 26007203 missense probably damaging 1.00
R7571:Fnta UTSW 8 26015465 missense probably benign 0.02
R7644:Fnta UTSW 8 26013488 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTAGCTTCCCTGTATCTACAAGAC -3'
(R):5'- AGCGTATTGGCCATGGAGAG -3'

Sequencing Primer
(F):5'- TCCCTGTATCTACAAGACTAATACAC -3'
(R):5'- CATGGAGAGTCGGTGCCAG -3'
Posted On2016-07-22