Incidental Mutation 'R5212:Crybg1'
ID403186
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
MMRRC Submission 042786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5212 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43967743 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1731 (F1731L)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020017
AA Change: F1357L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: F1357L

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200401
AA Change: F1731L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: F1731L

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Meta Mutation Damage Score 0.3329 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,065,850 S267T possibly damaging Het
Abca9 T C 11: 110,107,226 D1514G probably benign Het
Adamtsl4 T A 3: 95,677,670 D896V probably damaging Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Arglu1 T A 8: 8,683,843 R158W probably damaging Het
Arhgef7 A G 8: 11,728,388 E46G probably benign Het
Atg2b A G 12: 105,646,796 V1172A probably benign Het
Bhlhe23 T A 2: 180,776,093 K217N probably damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Ccp110 C T 7: 118,729,696 A845V probably damaging Het
Cd63 A G 10: 128,911,853 Y105C probably damaging Het
Cdk11b T C 4: 155,638,615 probably null Het
Clip1 T A 5: 123,630,681 R618S probably benign Het
Dock1 A C 7: 134,789,194 K728Q possibly damaging Het
Emc2 A G 15: 43,510,844 E180G probably damaging Het
F13b A T 1: 139,512,987 I394F probably benign Het
Fnta A G 8: 26,009,707 I155T probably benign Het
Fshr T A 17: 88,986,256 E331D probably benign Het
Fshr T A 17: 88,986,257 E331V probably benign Het
Gas2l1 A T 11: 5,061,108 C574S probably benign Het
Ggnbp2 T A 11: 84,854,021 probably benign Het
Gm3371 A C 14: 44,403,654 probably benign Het
Gm7489 T A 15: 53,885,620 probably benign Het
Hand1 A C 11: 57,831,447 F114V probably damaging Het
Itga4 A C 2: 79,280,595 H259P probably damaging Het
Jakmip1 A T 5: 37,104,901 H183L probably benign Het
Kif1bp A T 10: 62,563,129 probably benign Het
Krt8 G T 15: 101,997,967 A369D possibly damaging Het
Krt82 T C 15: 101,545,049 S301G probably damaging Het
Lig3 A G 11: 82,787,678 T248A probably benign Het
Madcam1 C G 10: 79,668,345 T255S probably benign Het
Med20 T C 17: 47,618,850 Y71H probably benign Het
Mtss1l A G 8: 110,729,218 I107V probably damaging Het
Nans T C 4: 46,502,547 F328S possibly damaging Het
Ncbp3 A G 11: 73,053,547 probably benign Het
Nek8 T C 11: 78,172,516 M1V probably null Het
Nufip1 A T 14: 76,133,098 N413I possibly damaging Het
Pbx3 T C 2: 34,288,781 probably benign Het
Plppr3 C T 10: 79,862,445 G419R probably benign Het
Rfx1 G T 8: 84,066,592 probably benign Het
Rnpepl1 C T 1: 92,911,323 A68V probably benign Het
Rsbn1l A T 5: 20,896,214 M776K probably benign Het
Setd7 A T 3: 51,542,817 Y63N probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snap47 T C 11: 59,428,352 E320G probably damaging Het
Spaca6 C A 17: 17,838,394 P68Q probably benign Het
Tdrd3 G C 14: 87,506,215 R527P probably damaging Het
Tmprss2 G T 16: 97,576,292 Q202K probably benign Het
Tmprss6 A G 15: 78,446,260 V69A probably damaging Het
Trav6-1 A T 14: 52,638,704 Q27L probably benign Het
Ttn T C 2: 76,789,601 I15908V probably benign Het
Ttn T A 2: 76,797,675 D12931V probably damaging Het
Ttn C T 2: 76,901,613 probably benign Het
Ush2a T A 1: 188,444,705 probably null Het
Wls A G 3: 159,873,008 N69S probably benign Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43997258 missense probably benign 0.05
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
RF024:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGGCCAGTGAAAGAATC -3'
(R):5'- TGGGGTCTGATCAGCAAAACAC -3'

Sequencing Primer
(F):5'- GGCCAGTGAAAGAATCCTAAGC -3'
(R):5'- GGGTCTGATCAGCAAAACACTTTTTC -3'
Posted On2016-07-22