Incidental Mutation 'R5212:Gas2l1'
ID403191
Institutional Source Beutler Lab
Gene Symbol Gas2l1
Ensembl Gene ENSMUSG00000034201
Gene Namegrowth arrest-specific 2 like 1
Synonyms4930500E24Rik, D0Jmb1, TU-71.1, GAR22
MMRRC Submission 042786-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5212 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5054132-5065327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5061108 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 574 (C574S)
Ref Sequence ENSEMBL: ENSMUSP00000105521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037146] [ENSMUST00000037218] [ENSMUST00000056649] [ENSMUST00000109895] [ENSMUST00000152257]
Predicted Effect probably benign
Transcript: ENSMUST00000037146
SMART Domains Protein: ENSMUSP00000043709
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037218
SMART Domains Protein: ENSMUSP00000048453
Gene: ENSMUSG00000034209

DomainStartEndE-ValueType
Pfam:Ras 6 180 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056649
AA Change: C574S

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050275
Gene: ENSMUSG00000034201
AA Change: C574S

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109895
AA Change: C574S

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105521
Gene: ENSMUSG00000034201
AA Change: C574S

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151936
Predicted Effect probably benign
Transcript: ENSMUST00000152257
SMART Domains Protein: ENSMUSP00000121993
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156196
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a member of the Gas2 family, actin-associated proteins expressed at high levels in growth-arrested cells. The gene expression is negatively regulated by serum and growth factors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,065,850 S267T possibly damaging Het
Abca9 T C 11: 110,107,226 D1514G probably benign Het
Adamtsl4 T A 3: 95,677,670 D896V probably damaging Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Arglu1 T A 8: 8,683,843 R158W probably damaging Het
Arhgef7 A G 8: 11,728,388 E46G probably benign Het
Atg2b A G 12: 105,646,796 V1172A probably benign Het
Bhlhe23 T A 2: 180,776,093 K217N probably damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Ccp110 C T 7: 118,729,696 A845V probably damaging Het
Cd63 A G 10: 128,911,853 Y105C probably damaging Het
Cdk11b T C 4: 155,638,615 probably null Het
Clip1 T A 5: 123,630,681 R618S probably benign Het
Crybg1 A T 10: 43,967,743 F1731L possibly damaging Het
Dock1 A C 7: 134,789,194 K728Q possibly damaging Het
Emc2 A G 15: 43,510,844 E180G probably damaging Het
F13b A T 1: 139,512,987 I394F probably benign Het
Fnta A G 8: 26,009,707 I155T probably benign Het
Fshr T A 17: 88,986,256 E331D probably benign Het
Fshr T A 17: 88,986,257 E331V probably benign Het
Ggnbp2 T A 11: 84,854,021 probably benign Het
Gm3371 A C 14: 44,403,654 probably benign Het
Gm7489 T A 15: 53,885,620 probably benign Het
Hand1 A C 11: 57,831,447 F114V probably damaging Het
Itga4 A C 2: 79,280,595 H259P probably damaging Het
Jakmip1 A T 5: 37,104,901 H183L probably benign Het
Kif1bp A T 10: 62,563,129 probably benign Het
Krt8 G T 15: 101,997,967 A369D possibly damaging Het
Krt82 T C 15: 101,545,049 S301G probably damaging Het
Lig3 A G 11: 82,787,678 T248A probably benign Het
Madcam1 C G 10: 79,668,345 T255S probably benign Het
Med20 T C 17: 47,618,850 Y71H probably benign Het
Mtss1l A G 8: 110,729,218 I107V probably damaging Het
Nans T C 4: 46,502,547 F328S possibly damaging Het
Ncbp3 A G 11: 73,053,547 probably benign Het
Nek8 T C 11: 78,172,516 M1V probably null Het
Nufip1 A T 14: 76,133,098 N413I possibly damaging Het
Pbx3 T C 2: 34,288,781 probably benign Het
Plppr3 C T 10: 79,862,445 G419R probably benign Het
Rfx1 G T 8: 84,066,592 probably benign Het
Rnpepl1 C T 1: 92,911,323 A68V probably benign Het
Rsbn1l A T 5: 20,896,214 M776K probably benign Het
Setd7 A T 3: 51,542,817 Y63N probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snap47 T C 11: 59,428,352 E320G probably damaging Het
Spaca6 C A 17: 17,838,394 P68Q probably benign Het
Tdrd3 G C 14: 87,506,215 R527P probably damaging Het
Tmprss2 G T 16: 97,576,292 Q202K probably benign Het
Tmprss6 A G 15: 78,446,260 V69A probably damaging Het
Trav6-1 A T 14: 52,638,704 Q27L probably benign Het
Ttn T C 2: 76,789,601 I15908V probably benign Het
Ttn T A 2: 76,797,675 D12931V probably damaging Het
Ttn C T 2: 76,901,613 probably benign Het
Ush2a T A 1: 188,444,705 probably null Het
Wls A G 3: 159,873,008 N69S probably benign Het
Other mutations in Gas2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0060:Gas2l1 UTSW 11 5062319 unclassified probably benign
R1606:Gas2l1 UTSW 11 5064434 missense probably damaging 1.00
R1719:Gas2l1 UTSW 11 5064266 missense probably damaging 1.00
R1934:Gas2l1 UTSW 11 5061408 missense probably benign 0.00
R4426:Gas2l1 UTSW 11 5063908 missense probably benign
R4427:Gas2l1 UTSW 11 5063908 missense probably benign
R4705:Gas2l1 UTSW 11 5060867 missense possibly damaging 0.71
R4811:Gas2l1 UTSW 11 5064436 missense probably damaging 1.00
R4817:Gas2l1 UTSW 11 5061429 missense possibly damaging 0.73
R4847:Gas2l1 UTSW 11 5064173 missense probably damaging 1.00
R6753:Gas2l1 UTSW 11 5064254 missense probably damaging 0.98
R7134:Gas2l1 UTSW 11 5061106 nonsense probably null
R7293:Gas2l1 UTSW 11 5064338 missense probably damaging 1.00
R8005:Gas2l1 UTSW 11 5061552 missense probably benign 0.24
R8061:Gas2l1 UTSW 11 5061785 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CATCGAAGAATCTGGCTCGG -3'
(R):5'- AACAGGCGGTACTGATGGTG -3'

Sequencing Primer
(F):5'- ATGCCAAGCCCCGAGTTCTATG -3'
(R):5'- TGCAGCTTGACCCACAG -3'
Posted On2016-07-22