Incidental Mutation 'R5212:Nek8'
ID403195
Institutional Source Beutler Lab
Gene Symbol Nek8
Ensembl Gene ENSMUSG00000017405
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 8
Synonyms
MMRRC Submission 042786-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R5212 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78166106-78176675 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 78172516 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000127554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017549] [ENSMUST00000098545] [ENSMUST00000148154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017549
AA Change: M141V

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000017549
Gene: ENSMUSG00000017405
AA Change: M141V

DomainStartEndE-ValueType
S_TKc 4 258 1.59e-81 SMART
low complexity region 288 316 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Pfam:RCC1 415 464 4.1e-12 PFAM
Pfam:RCC1_2 451 480 9.2e-10 PFAM
Pfam:RCC1 467 516 9.9e-16 PFAM
Pfam:RCC1 585 634 4.4e-15 PFAM
Pfam:RCC1 637 687 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098545
SMART Domains Protein: ENSMUSP00000096145
Gene: ENSMUSG00000019437

DomainStartEndE-ValueType
TLC 40 207 5.98e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147798
Predicted Effect probably null
Transcript: ENSMUST00000148154
AA Change: M1V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127554
Gene: ENSMUSG00000017405
AA Change: M1V

DomainStartEndE-ValueType
Pfam:Pkinase 1 103 4.1e-20 PFAM
Pfam:Pkinase_Tyr 1 103 3.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152611
Meta Mutation Damage Score 0.2211 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a NIMA-related kinase. Members of this serine/threonine protein kinase family are structurally-related to NIMA (never in mitosis, gene A) which controls mitotic signaling in Aspergillus nidulans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display kidney cysts primarily in the cortex, progressive kidney enlargement, increased serum creatinine levels, impaired maternal nurturing, and premature death. Heterotaxy with congenital heart disease such as hypoplastic right ventricle and small tricuspid valve is seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,065,850 S267T possibly damaging Het
Abca9 T C 11: 110,107,226 D1514G probably benign Het
Adamtsl4 T A 3: 95,677,670 D896V probably damaging Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Arglu1 T A 8: 8,683,843 R158W probably damaging Het
Arhgef7 A G 8: 11,728,388 E46G probably benign Het
Atg2b A G 12: 105,646,796 V1172A probably benign Het
Bhlhe23 T A 2: 180,776,093 K217N probably damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Ccp110 C T 7: 118,729,696 A845V probably damaging Het
Cd63 A G 10: 128,911,853 Y105C probably damaging Het
Cdk11b T C 4: 155,638,615 probably null Het
Clip1 T A 5: 123,630,681 R618S probably benign Het
Crybg1 A T 10: 43,967,743 F1731L possibly damaging Het
Dock1 A C 7: 134,789,194 K728Q possibly damaging Het
Emc2 A G 15: 43,510,844 E180G probably damaging Het
F13b A T 1: 139,512,987 I394F probably benign Het
Fnta A G 8: 26,009,707 I155T probably benign Het
Fshr T A 17: 88,986,256 E331D probably benign Het
Fshr T A 17: 88,986,257 E331V probably benign Het
Gas2l1 A T 11: 5,061,108 C574S probably benign Het
Ggnbp2 T A 11: 84,854,021 probably benign Het
Gm3371 A C 14: 44,403,654 probably benign Het
Gm7489 T A 15: 53,885,620 probably benign Het
Hand1 A C 11: 57,831,447 F114V probably damaging Het
Itga4 A C 2: 79,280,595 H259P probably damaging Het
Jakmip1 A T 5: 37,104,901 H183L probably benign Het
Kif1bp A T 10: 62,563,129 probably benign Het
Krt8 G T 15: 101,997,967 A369D possibly damaging Het
Krt82 T C 15: 101,545,049 S301G probably damaging Het
Lig3 A G 11: 82,787,678 T248A probably benign Het
Madcam1 C G 10: 79,668,345 T255S probably benign Het
Med20 T C 17: 47,618,850 Y71H probably benign Het
Mtss1l A G 8: 110,729,218 I107V probably damaging Het
Nans T C 4: 46,502,547 F328S possibly damaging Het
Ncbp3 A G 11: 73,053,547 probably benign Het
Nufip1 A T 14: 76,133,098 N413I possibly damaging Het
Pbx3 T C 2: 34,288,781 probably benign Het
Plppr3 C T 10: 79,862,445 G419R probably benign Het
Rfx1 G T 8: 84,066,592 probably benign Het
Rnpepl1 C T 1: 92,911,323 A68V probably benign Het
Rsbn1l A T 5: 20,896,214 M776K probably benign Het
Setd7 A T 3: 51,542,817 Y63N probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snap47 T C 11: 59,428,352 E320G probably damaging Het
Spaca6 C A 17: 17,838,394 P68Q probably benign Het
Tdrd3 G C 14: 87,506,215 R527P probably damaging Het
Tmprss2 G T 16: 97,576,292 Q202K probably benign Het
Tmprss6 A G 15: 78,446,260 V69A probably damaging Het
Trav6-1 A T 14: 52,638,704 Q27L probably benign Het
Ttn T C 2: 76,789,601 I15908V probably benign Het
Ttn T A 2: 76,797,675 D12931V probably damaging Het
Ttn C T 2: 76,901,613 probably benign Het
Ush2a T A 1: 188,444,705 probably null Het
Wls A G 3: 159,873,008 N69S probably benign Het
Other mutations in Nek8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nek8 APN 11 78167827 missense probably damaging 0.96
IGL00914:Nek8 APN 11 78173075 missense possibly damaging 0.80
nerkkod UTSW 11 78173059 missense probably damaging 1.00
R0136:Nek8 UTSW 11 78171207 missense probably benign 0.01
R0490:Nek8 UTSW 11 78167729 missense probably benign 0.01
R0657:Nek8 UTSW 11 78171207 missense probably benign 0.01
R1033:Nek8 UTSW 11 78171285 missense probably null 1.00
R2848:Nek8 UTSW 11 78168141 missense probably damaging 1.00
R3406:Nek8 UTSW 11 78170746 nonsense probably null
R4211:Nek8 UTSW 11 78170483 missense probably benign
R4810:Nek8 UTSW 11 78167803 missense probably benign 0.00
R4811:Nek8 UTSW 11 78167718 splice site probably null
R5108:Nek8 UTSW 11 78172527 missense probably damaging 0.96
R5124:Nek8 UTSW 11 78172939 missense probably damaging 1.00
R5177:Nek8 UTSW 11 78170471 nonsense probably null
R5386:Nek8 UTSW 11 78170437 unclassified probably null
R5921:Nek8 UTSW 11 78173059 missense probably damaging 1.00
R5977:Nek8 UTSW 11 78167825 missense probably benign 0.01
X0026:Nek8 UTSW 11 78168105 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCATTTGGGGATAGCTTCTCAAAG -3'
(R):5'- TGATTGGTTCTCTGGGCCAC -3'

Sequencing Primer
(F):5'- TTCTCAAAGCAGGCCTTGG -3'
(R):5'- TCTTTGTGCAGATCCTGC -3'
Posted On2016-07-22