Incidental Mutation 'R5212:Tdrd3'
ID 403204
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Name tudor domain containing 3
Synonyms 4732418C03Rik
MMRRC Submission 042786-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R5212 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 87416639-87545504 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 87506215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 527 (R527P)
Ref Sequence ENSEMBL: ENSMUSP00000126189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
AlphaFold Q91W18
Predicted Effect probably damaging
Transcript: ENSMUST00000168275
AA Change: R533P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019
AA Change: R533P

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169504
AA Change: R533P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: R533P

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170865
AA Change: R527P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019
AA Change: R527P

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,065,850 S267T possibly damaging Het
Abca9 T C 11: 110,107,226 D1514G probably benign Het
Adamtsl4 T A 3: 95,677,670 D896V probably damaging Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Arglu1 T A 8: 8,683,843 R158W probably damaging Het
Arhgef7 A G 8: 11,728,388 E46G probably benign Het
Atg2b A G 12: 105,646,796 V1172A probably benign Het
Bhlhe23 T A 2: 180,776,093 K217N probably damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Ccp110 C T 7: 118,729,696 A845V probably damaging Het
Cd63 A G 10: 128,911,853 Y105C probably damaging Het
Cdk11b T C 4: 155,638,615 probably null Het
Clip1 T A 5: 123,630,681 R618S probably benign Het
Crybg1 A T 10: 43,967,743 F1731L possibly damaging Het
Dock1 A C 7: 134,789,194 K728Q possibly damaging Het
Emc2 A G 15: 43,510,844 E180G probably damaging Het
F13b A T 1: 139,512,987 I394F probably benign Het
Fnta A G 8: 26,009,707 I155T probably benign Het
Fshr T A 17: 88,986,256 E331D probably benign Het
Fshr T A 17: 88,986,257 E331V probably benign Het
Gas2l1 A T 11: 5,061,108 C574S probably benign Het
Ggnbp2 T A 11: 84,854,021 probably benign Het
Gm3371 A C 14: 44,403,654 probably benign Het
Gm7489 T A 15: 53,885,620 probably benign Het
Hand1 A C 11: 57,831,447 F114V probably damaging Het
Itga4 A C 2: 79,280,595 H259P probably damaging Het
Jakmip1 A T 5: 37,104,901 H183L probably benign Het
Kif1bp A T 10: 62,563,129 probably benign Het
Krt8 G T 15: 101,997,967 A369D possibly damaging Het
Krt82 T C 15: 101,545,049 S301G probably damaging Het
Lig3 A G 11: 82,787,678 T248A probably benign Het
Madcam1 C G 10: 79,668,345 T255S probably benign Het
Med20 T C 17: 47,618,850 Y71H probably benign Het
Mtss1l A G 8: 110,729,218 I107V probably damaging Het
Nans T C 4: 46,502,547 F328S possibly damaging Het
Ncbp3 A G 11: 73,053,547 probably benign Het
Nek8 T C 11: 78,172,516 M1V probably null Het
Nufip1 A T 14: 76,133,098 N413I possibly damaging Het
Pbx3 T C 2: 34,288,781 probably benign Het
Plppr3 C T 10: 79,862,445 G419R probably benign Het
Rfx1 G T 8: 84,066,592 probably benign Het
Rnpepl1 C T 1: 92,911,323 A68V probably benign Het
Rsbn1l A T 5: 20,896,214 M776K probably benign Het
Setd7 A T 3: 51,542,817 Y63N probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snap47 T C 11: 59,428,352 E320G probably damaging Het
Spaca6 C A 17: 17,838,394 P68Q probably benign Het
Tmprss2 G T 16: 97,576,292 Q202K probably benign Het
Tmprss6 A G 15: 78,446,260 V69A probably damaging Het
Trav6-1 A T 14: 52,638,704 Q27L probably benign Het
Ttn T C 2: 76,789,601 I15908V probably benign Het
Ttn T A 2: 76,797,675 D12931V probably damaging Het
Ttn C T 2: 76,901,613 probably benign Het
Ush2a T A 1: 188,444,705 probably null Het
Wls A G 3: 159,873,008 N69S probably benign Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87480774 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2096:Tdrd3 UTSW 14 87506352 nonsense probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87506599 missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6532:Tdrd3 UTSW 14 87505816 missense probably damaging 0.98
R6850:Tdrd3 UTSW 14 87458079 intron probably benign
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7818:Tdrd3 UTSW 14 87472200 missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8206:Tdrd3 UTSW 14 87511778 missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87472201 nonsense probably null
R8985:Tdrd3 UTSW 14 87506161 missense possibly damaging 0.69
R9081:Tdrd3 UTSW 14 87506281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGACAGGCCATATTCTAGG -3'
(R):5'- ACTTAATCGGTCCTACGCGC -3'

Sequencing Primer
(F):5'- GTGACAGGCCATATTCTAGGTATGAC -3'
(R):5'- CTTCCTTTCAGAGGCGGAG -3'
Posted On 2016-07-22