Incidental Mutation 'R5212:Tmprss2'
ID403211
Institutional Source Beutler Lab
Gene Symbol Tmprss2
Ensembl Gene ENSMUSG00000000385
Gene Nametransmembrane protease, serine 2
Synonymsepitheliasin, D16Ertd61e
MMRRC Submission 042786-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5212 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97564682-97611195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97576292 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 202 (Q202K)
Ref Sequence ENSEMBL: ENSMUSP00000000395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000395] [ENSMUST00000231544]
Predicted Effect probably benign
Transcript: ENSMUST00000000395
AA Change: Q202K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000000395
Gene: ENSMUSG00000000385
AA Change: Q202K

DomainStartEndE-ValueType
transmembrane domain 86 108 N/A INTRINSIC
LDLa 111 149 1e-9 SMART
SR 148 241 8.55e-10 SMART
Tryp_SPc 253 482 4.58e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231908
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a type II transmembrane domain, a receptor class A domain, a scavenger receptor cysteine-rich domain and a protease domain. Serine proteases are known to be involved in many physiological and pathological processes. This gene was demonstrated to be up-regulated by androgenic hormones in prostate cancer cells and down-regulated in androgen-independent prostate cancer tissue. The protease domain of this protein is thought to be cleaved and secreted into cell media after autocleavage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,065,850 S267T possibly damaging Het
Abca9 T C 11: 110,107,226 D1514G probably benign Het
Adamtsl4 T A 3: 95,677,670 D896V probably damaging Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Arglu1 T A 8: 8,683,843 R158W probably damaging Het
Arhgef7 A G 8: 11,728,388 E46G probably benign Het
Atg2b A G 12: 105,646,796 V1172A probably benign Het
Bhlhe23 T A 2: 180,776,093 K217N probably damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Ccp110 C T 7: 118,729,696 A845V probably damaging Het
Cd63 A G 10: 128,911,853 Y105C probably damaging Het
Cdk11b T C 4: 155,638,615 probably null Het
Clip1 T A 5: 123,630,681 R618S probably benign Het
Crybg1 A T 10: 43,967,743 F1731L possibly damaging Het
Dock1 A C 7: 134,789,194 K728Q possibly damaging Het
Emc2 A G 15: 43,510,844 E180G probably damaging Het
F13b A T 1: 139,512,987 I394F probably benign Het
Fnta A G 8: 26,009,707 I155T probably benign Het
Fshr T A 17: 88,986,256 E331D probably benign Het
Fshr T A 17: 88,986,257 E331V probably benign Het
Gas2l1 A T 11: 5,061,108 C574S probably benign Het
Ggnbp2 T A 11: 84,854,021 probably benign Het
Gm3371 A C 14: 44,403,654 probably benign Het
Gm7489 T A 15: 53,885,620 probably benign Het
Hand1 A C 11: 57,831,447 F114V probably damaging Het
Itga4 A C 2: 79,280,595 H259P probably damaging Het
Jakmip1 A T 5: 37,104,901 H183L probably benign Het
Kif1bp A T 10: 62,563,129 probably benign Het
Krt8 G T 15: 101,997,967 A369D possibly damaging Het
Krt82 T C 15: 101,545,049 S301G probably damaging Het
Lig3 A G 11: 82,787,678 T248A probably benign Het
Madcam1 C G 10: 79,668,345 T255S probably benign Het
Med20 T C 17: 47,618,850 Y71H probably benign Het
Mtss1l A G 8: 110,729,218 I107V probably damaging Het
Nans T C 4: 46,502,547 F328S possibly damaging Het
Ncbp3 A G 11: 73,053,547 probably benign Het
Nek8 T C 11: 78,172,516 M1V probably null Het
Nufip1 A T 14: 76,133,098 N413I possibly damaging Het
Pbx3 T C 2: 34,288,781 probably benign Het
Plppr3 C T 10: 79,862,445 G419R probably benign Het
Rfx1 G T 8: 84,066,592 probably benign Het
Rnpepl1 C T 1: 92,911,323 A68V probably benign Het
Rsbn1l A T 5: 20,896,214 M776K probably benign Het
Setd7 A T 3: 51,542,817 Y63N probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snap47 T C 11: 59,428,352 E320G probably damaging Het
Spaca6 C A 17: 17,838,394 P68Q probably benign Het
Tdrd3 G C 14: 87,506,215 R527P probably damaging Het
Tmprss6 A G 15: 78,446,260 V69A probably damaging Het
Trav6-1 A T 14: 52,638,704 Q27L probably benign Het
Ttn T C 2: 76,789,601 I15908V probably benign Het
Ttn T A 2: 76,797,675 D12931V probably damaging Het
Ttn C T 2: 76,901,613 probably benign Het
Ush2a T A 1: 188,444,705 probably null Het
Wls A G 3: 159,873,008 N69S probably benign Het
Other mutations in Tmprss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Tmprss2 APN 16 97578595 nonsense probably null
IGL02130:Tmprss2 APN 16 97590889 missense probably damaging 1.00
IGL02149:Tmprss2 APN 16 97599279 utr 5 prime probably benign
IGL03080:Tmprss2 APN 16 97596844 missense probably damaging 0.98
PIT4480001:Tmprss2 UTSW 16 97599260 missense possibly damaging 0.77
R0395:Tmprss2 UTSW 16 97567045 missense probably damaging 1.00
R0485:Tmprss2 UTSW 16 97571994 unclassified probably benign
R1055:Tmprss2 UTSW 16 97576262 missense probably damaging 1.00
R1080:Tmprss2 UTSW 16 97591498 missense probably benign
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1930:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1931:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1955:Tmprss2 UTSW 16 97567177 critical splice acceptor site probably null
R2443:Tmprss2 UTSW 16 97568503 missense possibly damaging 0.65
R3825:Tmprss2 UTSW 16 97596821 missense probably damaging 1.00
R4508:Tmprss2 UTSW 16 97570427 missense probably damaging 1.00
R5571:Tmprss2 UTSW 16 97590871 missense probably null 1.00
R5715:Tmprss2 UTSW 16 97568983 missense possibly damaging 0.65
R6816:Tmprss2 UTSW 16 97568467 missense possibly damaging 0.94
R6921:Tmprss2 UTSW 16 97568437 missense probably damaging 0.98
R7230:Tmprss2 UTSW 16 97578597 missense probably benign 0.02
R7311:Tmprss2 UTSW 16 97568416 missense possibly damaging 0.94
R7788:Tmprss2 UTSW 16 97576229 nonsense probably null
R8052:Tmprss2 UTSW 16 97568416 missense probably damaging 1.00
R8329:Tmprss2 UTSW 16 97568465 missense probably benign 0.01
R8511:Tmprss2 UTSW 16 97568462 missense possibly damaging 0.94
Z1176:Tmprss2 UTSW 16 97567057 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGAAACACTGCTTACCTCC -3'
(R):5'- CAATGGTTTTCAGACAGCATGG -3'

Sequencing Primer
(F):5'- TTACCTCCACCCAAAACAGTCTAG -3'
(R):5'- CAGACAGCATGGTTGAATTTGGC -3'
Posted On2016-07-22