Incidental Mutation 'R5212:Spaca6'
ID403212
Institutional Source Beutler Lab
Gene Symbol Spaca6
Ensembl Gene ENSMUSG00000080316
Gene Namesperm acrosome associated 6
SynonymsB230206P06Rik, 4930546H06Rik, Ncrna00085
MMRRC Submission 042786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R5212 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17827158-17843009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 17838394 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 68 (P68Q)
Ref Sequence ENSEMBL: ENSMUSP00000154630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003762] [ENSMUST00000139969] [ENSMUST00000150302] [ENSMUST00000172097] [ENSMUST00000228490] [ENSMUST00000226899]
Predicted Effect probably benign
Transcript: ENSMUST00000003762
SMART Domains Protein: ENSMUSP00000003762
Gene: ENSMUSG00000003665

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 78 86 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 179 387 1.1e-21 PFAM
Pfam:Glyco_transf_21 205 386 1.2e-8 PFAM
Pfam:Chitin_synth_2 222 394 1.6e-16 PFAM
Pfam:Glyco_trans_2_3 237 453 5.6e-16 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000012759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137228
Predicted Effect probably benign
Transcript: ENSMUST00000139969
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150302
Predicted Effect probably benign
Transcript: ENSMUST00000154301
SMART Domains Protein: ENSMUSP00000117377
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
Blast:IG 27 78 2e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155293
Predicted Effect probably benign
Transcript: ENSMUST00000172097
AA Change: P285Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316
AA Change: P285Q

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179350
Predicted Effect probably benign
Transcript: ENSMUST00000228490
AA Change: P68Q

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000226899
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion that inactivates this gene exhibit impaired fertilization and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,065,850 S267T possibly damaging Het
Abca9 T C 11: 110,107,226 D1514G probably benign Het
Adamtsl4 T A 3: 95,677,670 D896V probably damaging Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Arglu1 T A 8: 8,683,843 R158W probably damaging Het
Arhgef7 A G 8: 11,728,388 E46G probably benign Het
Atg2b A G 12: 105,646,796 V1172A probably benign Het
Bhlhe23 T A 2: 180,776,093 K217N probably damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Ccp110 C T 7: 118,729,696 A845V probably damaging Het
Cd63 A G 10: 128,911,853 Y105C probably damaging Het
Cdk11b T C 4: 155,638,615 probably null Het
Clip1 T A 5: 123,630,681 R618S probably benign Het
Crybg1 A T 10: 43,967,743 F1731L possibly damaging Het
Dock1 A C 7: 134,789,194 K728Q possibly damaging Het
Emc2 A G 15: 43,510,844 E180G probably damaging Het
F13b A T 1: 139,512,987 I394F probably benign Het
Fnta A G 8: 26,009,707 I155T probably benign Het
Fshr T A 17: 88,986,256 E331D probably benign Het
Fshr T A 17: 88,986,257 E331V probably benign Het
Gas2l1 A T 11: 5,061,108 C574S probably benign Het
Ggnbp2 T A 11: 84,854,021 probably benign Het
Gm3371 A C 14: 44,403,654 probably benign Het
Gm7489 T A 15: 53,885,620 probably benign Het
Hand1 A C 11: 57,831,447 F114V probably damaging Het
Itga4 A C 2: 79,280,595 H259P probably damaging Het
Jakmip1 A T 5: 37,104,901 H183L probably benign Het
Kif1bp A T 10: 62,563,129 probably benign Het
Krt8 G T 15: 101,997,967 A369D possibly damaging Het
Krt82 T C 15: 101,545,049 S301G probably damaging Het
Lig3 A G 11: 82,787,678 T248A probably benign Het
Madcam1 C G 10: 79,668,345 T255S probably benign Het
Med20 T C 17: 47,618,850 Y71H probably benign Het
Mtss1l A G 8: 110,729,218 I107V probably damaging Het
Nans T C 4: 46,502,547 F328S possibly damaging Het
Ncbp3 A G 11: 73,053,547 probably benign Het
Nek8 T C 11: 78,172,516 M1V probably null Het
Nufip1 A T 14: 76,133,098 N413I possibly damaging Het
Pbx3 T C 2: 34,288,781 probably benign Het
Plppr3 C T 10: 79,862,445 G419R probably benign Het
Rfx1 G T 8: 84,066,592 probably benign Het
Rnpepl1 C T 1: 92,911,323 A68V probably benign Het
Rsbn1l A T 5: 20,896,214 M776K probably benign Het
Setd7 A T 3: 51,542,817 Y63N probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snap47 T C 11: 59,428,352 E320G probably damaging Het
Tdrd3 G C 14: 87,506,215 R527P probably damaging Het
Tmprss2 G T 16: 97,576,292 Q202K probably benign Het
Tmprss6 A G 15: 78,446,260 V69A probably damaging Het
Trav6-1 A T 14: 52,638,704 Q27L probably benign Het
Ttn T C 2: 76,789,601 I15908V probably benign Het
Ttn T A 2: 76,797,675 D12931V probably damaging Het
Ttn C T 2: 76,901,613 probably benign Het
Ush2a T A 1: 188,444,705 probably null Het
Wls A G 3: 159,873,008 N69S probably benign Het
Other mutations in Spaca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Spaca6 APN 17 17831167 missense probably benign 0.41
IGL02630:Spaca6 APN 17 17831089 missense probably damaging 1.00
IGL03010:Spaca6 APN 17 17838405 missense probably benign 0.01
IGL03352:Spaca6 APN 17 17838139 missense probably damaging 1.00
R0021:Spaca6 UTSW 17 17838236 nonsense probably null
R0964:Spaca6 UTSW 17 17838391 missense possibly damaging 0.46
R1941:Spaca6 UTSW 17 17838402 missense probably benign 0.05
R1941:Spaca6 UTSW 17 17838430 missense probably damaging 0.99
R2197:Spaca6 UTSW 17 17836154 critical splice donor site probably null
R2235:Spaca6 UTSW 17 17838245 critical splice donor site probably null
R4602:Spaca6 UTSW 17 17831125 missense probably damaging 0.99
R4645:Spaca6 UTSW 17 17836045 intron probably benign
R4672:Spaca6 UTSW 17 17836743 nonsense probably null
R5044:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R5222:Spaca6 UTSW 17 17838105 missense probably benign 0.02
R5528:Spaca6 UTSW 17 17831082 missense probably benign
R5854:Spaca6 UTSW 17 17831247 nonsense probably null
R6029:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R7041:Spaca6 UTSW 17 17836096 missense probably benign 0.14
R7268:Spaca6 UTSW 17 17832107 missense probably benign 0.09
R8281:Spaca6 UTSW 17 17832059 missense possibly damaging 0.78
Z1177:Spaca6 UTSW 17 17831052 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CGGCTCTACTTTTATCTGAACGG -3'
(R):5'- AGAAGACTTGGGTTGGACTGC -3'

Sequencing Primer
(F):5'- GTACGGGCGGGGTGAGG -3'
(R):5'- GAATAGGTTGCCAAGCGT -3'
Posted On2016-07-22