Incidental Mutation 'R0416:Robo4'
ID40324
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R0416 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 37404766 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]
Predicted Effect probably benign
Transcript: ENSMUST00000102895
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115046
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115048
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect probably benign
Transcript: ENSMUST00000214185
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
PIT4305001:Robo4 UTSW 9 37411391 missense probably damaging 1.00
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
R7707:Robo4 UTSW 9 37413122 missense probably damaging 1.00
R7839:Robo4 UTSW 9 37410759 missense probably damaging 1.00
R7922:Robo4 UTSW 9 37410759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGAGTGCAAAGCTTGGGG -3'
(R):5'- CTGGTTTGTAGCAGTCAGGGAAAGG -3'

Sequencing Primer
(F):5'- TTCCAATCCAGTCTGGAAGTTAGG -3'
(R):5'- GTTATGTGGAACTCCAGGGGAC -3'
Posted On2013-05-23