Incidental Mutation 'R5213:Tcaf3'
ID 403262
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 042854-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5213 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42568401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 652 (W652R)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably damaging
Transcript: ENSMUST00000069023
AA Change: W652R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: W652R

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151898
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,303,865 (GRCm39) H1342N possibly damaging Het
Adcy2 G T 13: 68,768,942 (GRCm39) T1062K possibly damaging Het
Aqr T C 2: 113,943,808 (GRCm39) N1110S probably damaging Het
Atp10a C T 7: 58,423,731 (GRCm39) T232I probably damaging Het
Atp5pb T A 3: 105,863,227 (GRCm39) K70* probably null Het
Atp8b4 A C 2: 126,231,329 (GRCm39) probably null Het
Atraid A C 5: 31,209,552 (GRCm39) Q72P probably damaging Het
Atxn2 G T 5: 121,952,543 (GRCm39) probably null Het
Best3 A T 10: 116,860,377 (GRCm39) T546S probably benign Het
Brd3 T C 2: 27,353,960 (GRCm39) K51E possibly damaging Het
Brip1 A G 11: 86,034,147 (GRCm39) S525P possibly damaging Het
Cenpf A G 1: 189,387,177 (GRCm39) I1701T probably benign Het
Chrna9 A T 5: 66,128,427 (GRCm39) K208* probably null Het
Clec2l T A 6: 38,657,127 (GRCm39) C197S probably damaging Het
Crp A G 1: 172,526,086 (GRCm39) H57R probably benign Het
Cyp27b1 C A 10: 126,887,964 (GRCm39) T492N probably damaging Het
Dock4 A T 12: 40,726,741 (GRCm39) I340F probably damaging Het
Dsg1b A T 18: 20,528,987 (GRCm39) D241V probably damaging Het
Epg5 G T 18: 78,058,049 (GRCm39) V1865L probably benign Het
Erap1 A G 13: 74,819,614 (GRCm39) probably null Het
Fat2 C T 11: 55,144,658 (GRCm39) C4072Y probably benign Het
Fat4 T A 3: 39,034,340 (GRCm39) I2664N possibly damaging Het
Gabrp A G 11: 33,517,211 (GRCm39) probably null Het
Glis2 G T 16: 4,431,946 (GRCm39) probably benign Het
Gm17654 A G 14: 43,816,559 (GRCm39) S15P probably damaging Het
Gm21836 A G 9: 124,252,736 (GRCm39) V14A unknown Het
Gon7 G A 12: 102,720,380 (GRCm39) T84I possibly damaging Het
Greb1 G T 12: 16,764,791 (GRCm39) Y447* probably null Het
Grip2 A T 6: 91,756,812 (GRCm39) D546E probably benign Het
Hectd1 A G 12: 51,849,316 (GRCm39) probably null Het
Il36a T A 2: 24,114,486 (GRCm39) F120L probably damaging Het
Itga4 T C 2: 79,150,920 (GRCm39) V842A probably benign Het
Khsrp G A 17: 57,331,366 (GRCm39) A404V probably benign Het
Map3k11 T C 19: 5,740,669 (GRCm39) V132A probably damaging Het
Mcub A C 3: 129,710,646 (GRCm39) F262C probably benign Het
Msantd5f6 G T 4: 73,319,571 (GRCm39) Q302K probably damaging Het
Mysm1 A T 4: 94,836,614 (GRCm39) V732E probably damaging Het
Npr2 T A 4: 43,640,673 (GRCm39) probably null Het
Or10d5 A C 9: 39,861,389 (GRCm39) I226S probably damaging Het
Or12d12 T C 17: 37,610,942 (GRCm39) I124V probably damaging Het
Or5k1b T C 16: 58,580,984 (GRCm39) Y185C probably damaging Het
Oxgr1 G T 14: 120,259,552 (GRCm39) Y218* probably null Het
Paf1 A G 7: 28,095,397 (GRCm39) Q161R possibly damaging Het
Pck1 A T 2: 172,997,878 (GRCm39) K316* probably null Het
Plac8 T A 5: 100,704,371 (GRCm39) M109L probably benign Het
Plagl2 A T 2: 153,074,239 (GRCm39) C221S probably damaging Het
Polg T C 7: 79,103,846 (GRCm39) D870G probably damaging Het
Polr2k T A 15: 36,175,143 (GRCm39) M1K probably null Het
Prdm9 T C 17: 15,775,416 (GRCm39) H276R probably damaging Het
Resf1 C A 6: 149,227,551 (GRCm39) P199Q possibly damaging Het
Rgs12 T A 5: 35,122,664 (GRCm39) I149N probably damaging Het
Serpina3i A G 12: 104,231,914 (GRCm39) I184V probably benign Het
Shank3 A G 15: 89,417,481 (GRCm39) E26G possibly damaging Het
Skil T C 3: 31,171,600 (GRCm39) S575P probably damaging Het
Slc13a1 A G 6: 24,108,158 (GRCm39) L306P probably damaging Het
Slc20a1 G T 2: 129,042,429 (GRCm39) W166L probably damaging Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Snrnp200 G T 2: 127,073,661 (GRCm39) G1353V probably damaging Het
Spata6l A T 19: 28,940,964 (GRCm39) V50E probably benign Het
Sphkap A G 1: 83,258,224 (GRCm39) I173T probably damaging Het
Stab2 A T 10: 86,743,061 (GRCm39) F1183I probably damaging Het
Stard9 A G 2: 120,529,707 (GRCm39) D1988G probably damaging Het
Tank T A 2: 61,480,292 (GRCm39) I276N probably benign Het
Tgm2 G A 2: 157,984,980 (GRCm39) T42I possibly damaging Het
Tnni2 G T 7: 141,997,039 (GRCm39) probably null Het
Tns1 A G 1: 73,992,771 (GRCm39) S9P probably damaging Het
Tram1 T C 1: 13,649,966 (GRCm39) Y86C probably damaging Het
Trdv2-1 T C 14: 54,183,863 (GRCm39) S32P probably benign Het
Trim24 T C 6: 37,934,010 (GRCm39) I651T probably damaging Het
Trpm3 T G 19: 22,674,818 (GRCm39) Y72* probably null Het
Ube2o G A 11: 116,432,285 (GRCm39) P894S possibly damaging Het
Ubr4 C T 4: 139,129,877 (GRCm39) R666* probably null Het
Ugt1a8 T A 1: 88,015,845 (GRCm39) L86* probably null Het
Usp32 T A 11: 84,913,085 (GRCm39) N941I probably damaging Het
Utrn C T 10: 12,512,504 (GRCm39) V2322M probably damaging Het
Vmn1r184 A T 7: 25,967,136 (GRCm39) Y294F probably damaging Het
Vmn2r108 T C 17: 20,691,755 (GRCm39) N256S probably benign Het
Wdr7 T C 18: 63,888,197 (GRCm39) S557P probably damaging Het
Xrra1 C A 7: 99,547,690 (GRCm39) P293Q possibly damaging Het
Zc3h18 A G 8: 123,110,388 (GRCm39) D79G probably damaging Het
Zfp74 A T 7: 29,634,668 (GRCm39) Y347N probably damaging Het
Zfp740 T C 15: 102,121,082 (GRCm39) C169R possibly damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCACGAAGTACCTACCG -3'
(R):5'- CTTCTGGGAGGTCTGAAAGG -3'

Sequencing Primer
(F):5'- GAAATCTGCTTGTCAAGTACGACC -3'
(R):5'- ATGTTGTGGGCCAAGCTA -3'
Posted On 2016-07-22