Mutagenetix > Incidental Mutations

Incidental Mutation 'R5213:Atp10a'

403268

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

042854-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R5213 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58773983 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 232 (T232I)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

Predicted Effect

probably damaging
Transcript: ENSMUST00000168747
AA Change: T232I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: T232I

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	A	6: 149,326,053	P199Q	possibly damaging	Het
4430402I18Rik	A	T	19: 28,963,564	V50E	probably benign	Het
Adamtsl1	C	A	4: 86,385,628	H1342N	possibly damaging	Het
Adcy2	G	T	13: 68,620,823	T1062K	possibly damaging	Het
Aqr	T	C	2: 114,113,327	N1110S	probably damaging	Het
Atp5f1	T	A	3: 105,955,911	K70*	probably null	Het
Atp8b4	A	C	2: 126,389,409		probably null	Het
Atraid	A	C	5: 31,052,208	Q72P	probably damaging	Het
Atxn2	G	T	5: 121,814,480		probably null	Het
Best3	A	T	10: 117,024,472	T546S	probably benign	Het
Brd3	T	C	2: 27,463,948	K51E	possibly damaging	Het
Brip1	A	G	11: 86,143,321	S525P	possibly damaging	Het
Ccdc109b	A	C	3: 129,916,997	F262C	probably benign	Het
Cenpf	A	G	1: 189,654,980	I1701T	probably benign	Het
Chrna9	A	T	5: 65,971,084	K208*	probably null	Het
Clec2l	T	A	6: 38,680,192	C197S	probably damaging	Het
Crp	A	G	1: 172,698,519	H57R	probably benign	Het
Cyp27b1	C	A	10: 127,052,095	T492N	probably damaging	Het
Dock4	A	T	12: 40,676,742	I340F	probably damaging	Het
Dsg1b	A	T	18: 20,395,930	D241V	probably damaging	Het
Epg5	G	T	18: 78,014,834	V1865L	probably benign	Het
Erap1	A	G	13: 74,671,495		probably null	Het
Fat2	C	T	11: 55,253,832	C4072Y	probably benign	Het
Fat4	T	A	3: 38,980,191	I2664N	possibly damaging	Het
Gabrp	A	G	11: 33,567,211		probably null	Het
Glis2	G	T	16: 4,614,082		probably benign	Het
Gm11487	G	T	4: 73,401,334	Q302K	probably damaging	Het
Gm17654	A	G	14: 43,579,102	S15P	probably damaging	Het
Gm21836	A	G	9: 124,493,753	V14A	unknown	Het
Gon7	G	A	12: 102,754,121	T84I	possibly damaging	Het
Greb1	G	T	12: 16,714,790	Y447*	probably null	Het
Grip2	A	T	6: 91,779,831	D546E	probably benign	Het
Hectd1	A	G	12: 51,802,533		probably null	Het
Il1f6	T	A	2: 24,224,474	F120L	probably damaging	Het
Itga4	T	C	2: 79,320,576	V842A	probably benign	Het
Khsrp	G	A	17: 57,024,366	A404V	probably benign	Het
Map3k11	T	C	19: 5,690,641	V132A	probably damaging	Het
Mysm1	A	T	4: 94,948,377	V732E	probably damaging	Het
Npr2	T	A	4: 43,640,673		probably null	Het
Olfr101	T	C	17: 37,300,051	I124V	probably damaging	Het
Olfr172	T	C	16: 58,760,621	Y185C	probably damaging	Het
Olfr975	A	C	9: 39,950,093	I226S	probably damaging	Het
Oxgr1	G	T	14: 120,022,140	Y218*	probably null	Het
Paf1	A	G	7: 28,395,972	Q161R	possibly damaging	Het
Pck1	A	T	2: 173,156,085	K316*	probably null	Het
Plac8	T	A	5: 100,556,505	M109L	probably benign	Het
Plagl2	A	T	2: 153,232,319	C221S	probably damaging	Het
Polg	T	C	7: 79,454,098	D870G	probably damaging	Het
Polr2k	T	A	15: 36,174,997	M1K	probably null	Het
Prdm9	T	C	17: 15,555,154	H276R	probably damaging	Het
Rgs12	T	A	5: 34,965,320	I149N	probably damaging	Het
Serpina3i	A	G	12: 104,265,655	I184V	probably benign	Het
Shank3	A	G	15: 89,533,278	E26G	possibly damaging	Het
Skil	T	C	3: 31,117,451	S575P	probably damaging	Het
Slc13a1	A	G	6: 24,108,159	L306P	probably damaging	Het
Slc20a1	G	T	2: 129,200,509	W166L	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Snrnp200	G	T	2: 127,231,741	G1353V	probably damaging	Het
Sphkap	A	G	1: 83,280,503	I173T	probably damaging	Het
Stab2	A	T	10: 86,907,197	F1183I	probably damaging	Het
Stard9	A	G	2: 120,699,226	D1988G	probably damaging	Het
Tank	T	A	2: 61,649,948	I276N	probably benign	Het
Tcaf3	A	G	6: 42,591,467	W652R	probably damaging	Het
Tgm2	G	A	2: 158,143,060	T42I	possibly damaging	Het
Tnni2	G	T	7: 142,443,302		probably null	Het
Tns1	A	G	1: 73,953,612	S9P	probably damaging	Het
Tram1	T	C	1: 13,579,742	Y86C	probably damaging	Het
Trdv2-1	T	C	14: 53,946,406	S32P	probably benign	Het
Trim24	T	C	6: 37,957,075	I651T	probably damaging	Het
Trpm3	T	G	19: 22,697,454	Y72*	probably null	Het
Ube2o	G	A	11: 116,541,459	P894S	possibly damaging	Het
Ubr4	C	T	4: 139,402,566	R666*	probably null	Het
Ugt1a8	T	A	1: 88,088,123	L86*	probably null	Het
Usp32	T	A	11: 85,022,259	N941I	probably damaging	Het
Utrn	C	T	10: 12,636,760	V2322M	probably damaging	Het
Vmn1r184	A	T	7: 26,267,711	Y294F	probably damaging	Het
Vmn2r108	T	C	17: 20,471,493	N256S	probably benign	Het
Wdr7	T	C	18: 63,755,126	S557P	probably damaging	Het
Xrra1	C	A	7: 99,898,483	P293Q	possibly damaging	Het
Zc3h18	A	G	8: 122,383,649	D79G	probably damaging	Het
Zfp74	A	T	7: 29,935,243	Y347N	probably damaging	Het
Zfp740	T	C	15: 102,212,647	C169R	possibly damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTCACTATCCACAAGTCTGTTCATAG -3'
(R):5'- TTGACAAGCTCCCACTGCTG -3'

Sequencing Primer
(F):5'- TCCACAAGTCTGTTCATAGTTAAAAC -3'
(R):5'- GTCAACCAAAAATGATGTATGTGGC -3'

Posted On

2016-07-22