Incidental Mutation 'R0416:Arih1'
ID40327
Institutional Source Beutler Lab
Gene Symbol Arih1
Ensembl Gene ENSMUSG00000025234
Gene Nameariadne RBR E3 ubiquitin protein ligase 1
SynonymsUIP77
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R0416 (G1)
Quality Score101
Status Validated
Chromosome9
Chromosomal Location59388258-59486618 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 59426710 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026264] [ENSMUST00000165322] [ENSMUST00000171975]
Predicted Effect probably benign
Transcript: ENSMUST00000026264
SMART Domains Protein: ENSMUSP00000026264
Gene: ENSMUSG00000025234

DomainStartEndE-ValueType
low complexity region 10 57 N/A INTRINSIC
low complexity region 60 90 N/A INTRINSIC
RING 184 232 1.34e-1 SMART
IBR 254 301 8.2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165322
SMART Domains Protein: ENSMUSP00000131516
Gene: ENSMUSG00000025234

DomainStartEndE-ValueType
low complexity region 10 46 N/A INTRINSIC
RING 105 153 1.34e-1 SMART
IBR 175 236 1.16e-25 SMART
RING 195 266 2.01e0 SMART
IBR 244 308 2.75e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168497
Predicted Effect probably benign
Transcript: ENSMUST00000171975
SMART Domains Protein: ENSMUSP00000126531
Gene: ENSMUSG00000025234

DomainStartEndE-ValueType
low complexity region 10 57 N/A INTRINSIC
low complexity region 60 90 N/A INTRINSIC
RING 184 232 1.34e-1 SMART
IBR 254 315 1.16e-25 SMART
RING 274 345 2.01e0 SMART
IBR 323 387 2.75e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Arih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Arih1 APN 9 59426169 missense probably damaging 1.00
IGL02616:Arih1 APN 9 59412476 missense probably benign 0.41
P0037:Arih1 UTSW 9 59405793 missense possibly damaging 0.46
R0411:Arih1 UTSW 9 59485983 missense possibly damaging 0.93
R0602:Arih1 UTSW 9 59394871 splice site probably benign
R1513:Arih1 UTSW 9 59403380 missense probably damaging 1.00
R1934:Arih1 UTSW 9 59394932 missense probably damaging 1.00
R4880:Arih1 UTSW 9 59436885 missense possibly damaging 0.83
R5023:Arih1 UTSW 9 59486232 missense unknown
R5057:Arih1 UTSW 9 59486232 missense unknown
R5317:Arih1 UTSW 9 59393336 missense probably benign 0.02
R7348:Arih1 UTSW 9 59486058 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCGCAGGACACGAAATAGTCTGAAAA -3'
(R):5'- CATTCCTGATAATTGGGTAGTCTGTCTTCAAA -3'

Sequencing Primer
(F):5'- gcactctcctagattctgatgac -3'
(R):5'- GGTAGTCTGTCTTCAAAGAAGTTAG -3'
Posted On2013-05-23