Incidental Mutation 'R5213:Or10d5'
ID 403274
Institutional Source Beutler Lab
Gene Symbol Or10d5
Ensembl Gene ENSMUSG00000043331
Gene Name olfactory receptor family 10 subfamily D member 5
Synonyms MOR224-2, GA_x6K02T2PVTD-33651220-33650288, Olfr975
MMRRC Submission 042854-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R5213 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 39861133-39862065 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 39861389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 226 (I226S)
Ref Sequence ENSEMBL: ENSMUSP00000150664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054067] [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000213246] [ENSMUST00000216647] [ENSMUST00000217630]
AlphaFold Q8VG91
Predicted Effect probably damaging
Transcript: ENSMUST00000054067
AA Change: I226S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059776
Gene: ENSMUSG00000043331
AA Change: I226S

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 249 1.8e-7 PFAM
Pfam:7tm_1 39 286 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169307
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213171
Predicted Effect probably benign
Transcript: ENSMUST00000213246
Predicted Effect probably damaging
Transcript: ENSMUST00000216647
AA Change: I226S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000217630
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,303,865 (GRCm39) H1342N possibly damaging Het
Adcy2 G T 13: 68,768,942 (GRCm39) T1062K possibly damaging Het
Aqr T C 2: 113,943,808 (GRCm39) N1110S probably damaging Het
Atp10a C T 7: 58,423,731 (GRCm39) T232I probably damaging Het
Atp5pb T A 3: 105,863,227 (GRCm39) K70* probably null Het
Atp8b4 A C 2: 126,231,329 (GRCm39) probably null Het
Atraid A C 5: 31,209,552 (GRCm39) Q72P probably damaging Het
Atxn2 G T 5: 121,952,543 (GRCm39) probably null Het
Best3 A T 10: 116,860,377 (GRCm39) T546S probably benign Het
Brd3 T C 2: 27,353,960 (GRCm39) K51E possibly damaging Het
Brip1 A G 11: 86,034,147 (GRCm39) S525P possibly damaging Het
Cenpf A G 1: 189,387,177 (GRCm39) I1701T probably benign Het
Chrna9 A T 5: 66,128,427 (GRCm39) K208* probably null Het
Clec2l T A 6: 38,657,127 (GRCm39) C197S probably damaging Het
Crp A G 1: 172,526,086 (GRCm39) H57R probably benign Het
Cyp27b1 C A 10: 126,887,964 (GRCm39) T492N probably damaging Het
Dock4 A T 12: 40,726,741 (GRCm39) I340F probably damaging Het
Dsg1b A T 18: 20,528,987 (GRCm39) D241V probably damaging Het
Epg5 G T 18: 78,058,049 (GRCm39) V1865L probably benign Het
Erap1 A G 13: 74,819,614 (GRCm39) probably null Het
Fat2 C T 11: 55,144,658 (GRCm39) C4072Y probably benign Het
Fat4 T A 3: 39,034,340 (GRCm39) I2664N possibly damaging Het
Gabrp A G 11: 33,517,211 (GRCm39) probably null Het
Glis2 G T 16: 4,431,946 (GRCm39) probably benign Het
Gm17654 A G 14: 43,816,559 (GRCm39) S15P probably damaging Het
Gm21836 A G 9: 124,252,736 (GRCm39) V14A unknown Het
Gon7 G A 12: 102,720,380 (GRCm39) T84I possibly damaging Het
Greb1 G T 12: 16,764,791 (GRCm39) Y447* probably null Het
Grip2 A T 6: 91,756,812 (GRCm39) D546E probably benign Het
Hectd1 A G 12: 51,849,316 (GRCm39) probably null Het
Il36a T A 2: 24,114,486 (GRCm39) F120L probably damaging Het
Itga4 T C 2: 79,150,920 (GRCm39) V842A probably benign Het
Khsrp G A 17: 57,331,366 (GRCm39) A404V probably benign Het
Map3k11 T C 19: 5,740,669 (GRCm39) V132A probably damaging Het
Mcub A C 3: 129,710,646 (GRCm39) F262C probably benign Het
Msantd5f6 G T 4: 73,319,571 (GRCm39) Q302K probably damaging Het
Mysm1 A T 4: 94,836,614 (GRCm39) V732E probably damaging Het
Npr2 T A 4: 43,640,673 (GRCm39) probably null Het
Or12d12 T C 17: 37,610,942 (GRCm39) I124V probably damaging Het
Or5k1b T C 16: 58,580,984 (GRCm39) Y185C probably damaging Het
Oxgr1 G T 14: 120,259,552 (GRCm39) Y218* probably null Het
Paf1 A G 7: 28,095,397 (GRCm39) Q161R possibly damaging Het
Pck1 A T 2: 172,997,878 (GRCm39) K316* probably null Het
Plac8 T A 5: 100,704,371 (GRCm39) M109L probably benign Het
Plagl2 A T 2: 153,074,239 (GRCm39) C221S probably damaging Het
Polg T C 7: 79,103,846 (GRCm39) D870G probably damaging Het
Polr2k T A 15: 36,175,143 (GRCm39) M1K probably null Het
Prdm9 T C 17: 15,775,416 (GRCm39) H276R probably damaging Het
Resf1 C A 6: 149,227,551 (GRCm39) P199Q possibly damaging Het
Rgs12 T A 5: 35,122,664 (GRCm39) I149N probably damaging Het
Serpina3i A G 12: 104,231,914 (GRCm39) I184V probably benign Het
Shank3 A G 15: 89,417,481 (GRCm39) E26G possibly damaging Het
Skil T C 3: 31,171,600 (GRCm39) S575P probably damaging Het
Slc13a1 A G 6: 24,108,158 (GRCm39) L306P probably damaging Het
Slc20a1 G T 2: 129,042,429 (GRCm39) W166L probably damaging Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Snrnp200 G T 2: 127,073,661 (GRCm39) G1353V probably damaging Het
Spata6l A T 19: 28,940,964 (GRCm39) V50E probably benign Het
Sphkap A G 1: 83,258,224 (GRCm39) I173T probably damaging Het
Stab2 A T 10: 86,743,061 (GRCm39) F1183I probably damaging Het
Stard9 A G 2: 120,529,707 (GRCm39) D1988G probably damaging Het
Tank T A 2: 61,480,292 (GRCm39) I276N probably benign Het
Tcaf3 A G 6: 42,568,401 (GRCm39) W652R probably damaging Het
Tgm2 G A 2: 157,984,980 (GRCm39) T42I possibly damaging Het
Tnni2 G T 7: 141,997,039 (GRCm39) probably null Het
Tns1 A G 1: 73,992,771 (GRCm39) S9P probably damaging Het
Tram1 T C 1: 13,649,966 (GRCm39) Y86C probably damaging Het
Trdv2-1 T C 14: 54,183,863 (GRCm39) S32P probably benign Het
Trim24 T C 6: 37,934,010 (GRCm39) I651T probably damaging Het
Trpm3 T G 19: 22,674,818 (GRCm39) Y72* probably null Het
Ube2o G A 11: 116,432,285 (GRCm39) P894S possibly damaging Het
Ubr4 C T 4: 139,129,877 (GRCm39) R666* probably null Het
Ugt1a8 T A 1: 88,015,845 (GRCm39) L86* probably null Het
Usp32 T A 11: 84,913,085 (GRCm39) N941I probably damaging Het
Utrn C T 10: 12,512,504 (GRCm39) V2322M probably damaging Het
Vmn1r184 A T 7: 25,967,136 (GRCm39) Y294F probably damaging Het
Vmn2r108 T C 17: 20,691,755 (GRCm39) N256S probably benign Het
Wdr7 T C 18: 63,888,197 (GRCm39) S557P probably damaging Het
Xrra1 C A 7: 99,547,690 (GRCm39) P293Q possibly damaging Het
Zc3h18 A G 8: 123,110,388 (GRCm39) D79G probably damaging Het
Zfp74 A T 7: 29,634,668 (GRCm39) Y347N probably damaging Het
Zfp740 T C 15: 102,121,082 (GRCm39) C169R possibly damaging Het
Other mutations in Or10d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Or10d5 APN 9 39,861,284 (GRCm39) missense probably benign 0.01
IGL01537:Or10d5 APN 9 39,861,921 (GRCm39) missense probably benign 0.00
IGL01963:Or10d5 APN 9 39,861,536 (GRCm39) missense probably damaging 1.00
IGL02400:Or10d5 APN 9 39,861,635 (GRCm39) missense probably benign
IGL03115:Or10d5 APN 9 39,862,040 (GRCm39) missense probably damaging 0.98
IGL03226:Or10d5 APN 9 39,861,719 (GRCm39) splice site probably null
R0088:Or10d5 UTSW 9 39,861,671 (GRCm39) missense probably benign 0.03
R0212:Or10d5 UTSW 9 39,861,236 (GRCm39) missense probably benign 0.44
R1668:Or10d5 UTSW 9 39,861,465 (GRCm39) missense possibly damaging 0.94
R1878:Or10d5 UTSW 9 39,862,053 (GRCm39) missense probably benign 0.35
R2225:Or10d5 UTSW 9 39,861,833 (GRCm39) missense possibly damaging 0.84
R2291:Or10d5 UTSW 9 39,861,630 (GRCm39) missense probably benign 0.19
R2420:Or10d5 UTSW 9 39,861,824 (GRCm39) missense possibly damaging 0.47
R2421:Or10d5 UTSW 9 39,861,824 (GRCm39) missense possibly damaging 0.47
R2422:Or10d5 UTSW 9 39,861,824 (GRCm39) missense possibly damaging 0.47
R2425:Or10d5 UTSW 9 39,861,137 (GRCm39) missense probably null 0.25
R2918:Or10d5 UTSW 9 39,861,660 (GRCm39) missense probably benign
R4536:Or10d5 UTSW 9 39,861,731 (GRCm39) missense probably damaging 1.00
R4709:Or10d5 UTSW 9 39,861,165 (GRCm39) missense probably damaging 0.97
R4831:Or10d5 UTSW 9 39,861,408 (GRCm39) missense probably benign 0.01
R4921:Or10d5 UTSW 9 39,861,521 (GRCm39) missense probably damaging 0.98
R5113:Or10d5 UTSW 9 39,861,221 (GRCm39) missense probably damaging 0.99
R5141:Or10d5 UTSW 9 39,861,170 (GRCm39) missense probably benign 0.07
R5195:Or10d5 UTSW 9 39,861,975 (GRCm39) missense probably benign
R5568:Or10d5 UTSW 9 39,861,983 (GRCm39) missense probably benign 0.05
R6993:Or10d5 UTSW 9 39,861,933 (GRCm39) missense probably benign
R7080:Or10d5 UTSW 9 39,861,444 (GRCm39) missense probably damaging 1.00
R7436:Or10d5 UTSW 9 39,861,349 (GRCm39) nonsense probably null
R8178:Or10d5 UTSW 9 39,861,708 (GRCm39) missense probably benign 0.05
R8179:Or10d5 UTSW 9 39,861,708 (GRCm39) missense probably benign 0.05
R8382:Or10d5 UTSW 9 39,861,455 (GRCm39) missense probably benign 0.21
R8402:Or10d5 UTSW 9 39,861,713 (GRCm39) missense probably benign 0.39
R8511:Or10d5 UTSW 9 39,861,455 (GRCm39) missense probably benign 0.21
R8798:Or10d5 UTSW 9 39,862,013 (GRCm39) missense probably benign 0.40
R9068:Or10d5 UTSW 9 39,862,087 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAATGCCTTTCTCAAAGCCAC -3'
(R):5'- CTGTGGACCCAATGAAGTGG -3'

Sequencing Primer
(F):5'- AATGCCTTTCTCAAAGCCACCTTTAC -3'
(R):5'- GGATAACTTTTTCTGCGACATTCCAG -3'
Posted On 2016-07-22