Incidental Mutation 'R5213:Stab2'
ID 403278
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms FEEL-2, STAB-2
MMRRC Submission 042854-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5213 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86677062-86843889 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86743061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1183 (F1183I)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably damaging
Transcript: ENSMUST00000035288
AA Change: F1183I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: F1183I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162458
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,303,865 (GRCm39) H1342N possibly damaging Het
Adcy2 G T 13: 68,768,942 (GRCm39) T1062K possibly damaging Het
Aqr T C 2: 113,943,808 (GRCm39) N1110S probably damaging Het
Atp10a C T 7: 58,423,731 (GRCm39) T232I probably damaging Het
Atp5pb T A 3: 105,863,227 (GRCm39) K70* probably null Het
Atp8b4 A C 2: 126,231,329 (GRCm39) probably null Het
Atraid A C 5: 31,209,552 (GRCm39) Q72P probably damaging Het
Atxn2 G T 5: 121,952,543 (GRCm39) probably null Het
Best3 A T 10: 116,860,377 (GRCm39) T546S probably benign Het
Brd3 T C 2: 27,353,960 (GRCm39) K51E possibly damaging Het
Brip1 A G 11: 86,034,147 (GRCm39) S525P possibly damaging Het
Cenpf A G 1: 189,387,177 (GRCm39) I1701T probably benign Het
Chrna9 A T 5: 66,128,427 (GRCm39) K208* probably null Het
Clec2l T A 6: 38,657,127 (GRCm39) C197S probably damaging Het
Crp A G 1: 172,526,086 (GRCm39) H57R probably benign Het
Cyp27b1 C A 10: 126,887,964 (GRCm39) T492N probably damaging Het
Dock4 A T 12: 40,726,741 (GRCm39) I340F probably damaging Het
Dsg1b A T 18: 20,528,987 (GRCm39) D241V probably damaging Het
Epg5 G T 18: 78,058,049 (GRCm39) V1865L probably benign Het
Erap1 A G 13: 74,819,614 (GRCm39) probably null Het
Fat2 C T 11: 55,144,658 (GRCm39) C4072Y probably benign Het
Fat4 T A 3: 39,034,340 (GRCm39) I2664N possibly damaging Het
Gabrp A G 11: 33,517,211 (GRCm39) probably null Het
Glis2 G T 16: 4,431,946 (GRCm39) probably benign Het
Gm17654 A G 14: 43,816,559 (GRCm39) S15P probably damaging Het
Gm21836 A G 9: 124,252,736 (GRCm39) V14A unknown Het
Gon7 G A 12: 102,720,380 (GRCm39) T84I possibly damaging Het
Greb1 G T 12: 16,764,791 (GRCm39) Y447* probably null Het
Grip2 A T 6: 91,756,812 (GRCm39) D546E probably benign Het
Hectd1 A G 12: 51,849,316 (GRCm39) probably null Het
Il36a T A 2: 24,114,486 (GRCm39) F120L probably damaging Het
Itga4 T C 2: 79,150,920 (GRCm39) V842A probably benign Het
Khsrp G A 17: 57,331,366 (GRCm39) A404V probably benign Het
Map3k11 T C 19: 5,740,669 (GRCm39) V132A probably damaging Het
Mcub A C 3: 129,710,646 (GRCm39) F262C probably benign Het
Msantd5f6 G T 4: 73,319,571 (GRCm39) Q302K probably damaging Het
Mysm1 A T 4: 94,836,614 (GRCm39) V732E probably damaging Het
Npr2 T A 4: 43,640,673 (GRCm39) probably null Het
Or10d5 A C 9: 39,861,389 (GRCm39) I226S probably damaging Het
Or12d12 T C 17: 37,610,942 (GRCm39) I124V probably damaging Het
Or5k1b T C 16: 58,580,984 (GRCm39) Y185C probably damaging Het
Oxgr1 G T 14: 120,259,552 (GRCm39) Y218* probably null Het
Paf1 A G 7: 28,095,397 (GRCm39) Q161R possibly damaging Het
Pck1 A T 2: 172,997,878 (GRCm39) K316* probably null Het
Plac8 T A 5: 100,704,371 (GRCm39) M109L probably benign Het
Plagl2 A T 2: 153,074,239 (GRCm39) C221S probably damaging Het
Polg T C 7: 79,103,846 (GRCm39) D870G probably damaging Het
Polr2k T A 15: 36,175,143 (GRCm39) M1K probably null Het
Prdm9 T C 17: 15,775,416 (GRCm39) H276R probably damaging Het
Resf1 C A 6: 149,227,551 (GRCm39) P199Q possibly damaging Het
Rgs12 T A 5: 35,122,664 (GRCm39) I149N probably damaging Het
Serpina3i A G 12: 104,231,914 (GRCm39) I184V probably benign Het
Shank3 A G 15: 89,417,481 (GRCm39) E26G possibly damaging Het
Skil T C 3: 31,171,600 (GRCm39) S575P probably damaging Het
Slc13a1 A G 6: 24,108,158 (GRCm39) L306P probably damaging Het
Slc20a1 G T 2: 129,042,429 (GRCm39) W166L probably damaging Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Snrnp200 G T 2: 127,073,661 (GRCm39) G1353V probably damaging Het
Spata6l A T 19: 28,940,964 (GRCm39) V50E probably benign Het
Sphkap A G 1: 83,258,224 (GRCm39) I173T probably damaging Het
Stard9 A G 2: 120,529,707 (GRCm39) D1988G probably damaging Het
Tank T A 2: 61,480,292 (GRCm39) I276N probably benign Het
Tcaf3 A G 6: 42,568,401 (GRCm39) W652R probably damaging Het
Tgm2 G A 2: 157,984,980 (GRCm39) T42I possibly damaging Het
Tnni2 G T 7: 141,997,039 (GRCm39) probably null Het
Tns1 A G 1: 73,992,771 (GRCm39) S9P probably damaging Het
Tram1 T C 1: 13,649,966 (GRCm39) Y86C probably damaging Het
Trdv2-1 T C 14: 54,183,863 (GRCm39) S32P probably benign Het
Trim24 T C 6: 37,934,010 (GRCm39) I651T probably damaging Het
Trpm3 T G 19: 22,674,818 (GRCm39) Y72* probably null Het
Ube2o G A 11: 116,432,285 (GRCm39) P894S possibly damaging Het
Ubr4 C T 4: 139,129,877 (GRCm39) R666* probably null Het
Ugt1a8 T A 1: 88,015,845 (GRCm39) L86* probably null Het
Usp32 T A 11: 84,913,085 (GRCm39) N941I probably damaging Het
Utrn C T 10: 12,512,504 (GRCm39) V2322M probably damaging Het
Vmn1r184 A T 7: 25,967,136 (GRCm39) Y294F probably damaging Het
Vmn2r108 T C 17: 20,691,755 (GRCm39) N256S probably benign Het
Wdr7 T C 18: 63,888,197 (GRCm39) S557P probably damaging Het
Xrra1 C A 7: 99,547,690 (GRCm39) P293Q possibly damaging Het
Zc3h18 A G 8: 123,110,388 (GRCm39) D79G probably damaging Het
Zfp74 A T 7: 29,634,668 (GRCm39) Y347N probably damaging Het
Zfp740 T C 15: 102,121,082 (GRCm39) C169R possibly damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86,705,070 (GRCm39) splice site probably null
IGL00809:Stab2 APN 10 86,684,038 (GRCm39) splice site probably benign
IGL00911:Stab2 APN 10 86,805,617 (GRCm39) missense probably damaging 1.00
IGL01347:Stab2 APN 10 86,737,567 (GRCm39) splice site probably null
IGL01411:Stab2 APN 10 86,815,872 (GRCm39) splice site probably benign
IGL01503:Stab2 APN 10 86,776,477 (GRCm39) splice site probably benign
IGL01599:Stab2 APN 10 86,758,759 (GRCm39) missense probably damaging 1.00
IGL01635:Stab2 APN 10 86,816,992 (GRCm39) missense probably benign 0.04
IGL01640:Stab2 APN 10 86,790,035 (GRCm39) missense probably benign 0.09
IGL01671:Stab2 APN 10 86,805,141 (GRCm39) missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86,707,695 (GRCm39) missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86,803,514 (GRCm39) missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86,695,606 (GRCm39) splice site probably null
IGL02600:Stab2 APN 10 86,790,123 (GRCm39) missense probably damaging 1.00
IGL02666:Stab2 APN 10 86,686,766 (GRCm39) missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86,682,027 (GRCm39) splice site probably benign
IGL02709:Stab2 APN 10 86,682,029 (GRCm39) splice site probably benign
IGL02728:Stab2 APN 10 86,692,420 (GRCm39) missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86,786,133 (GRCm39) splice site probably benign
IGL02938:Stab2 APN 10 86,707,785 (GRCm39) missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86,832,667 (GRCm39) critical splice donor site probably null
IGL03238:Stab2 APN 10 86,690,985 (GRCm39) missense probably damaging 1.00
IGL03402:Stab2 APN 10 86,805,165 (GRCm39) missense probably benign 0.03
prospector UTSW 10 86,737,431 (GRCm39) splice site probably null
songbird UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
3-1:Stab2 UTSW 10 86,705,041 (GRCm39) missense probably damaging 0.96
F6893:Stab2 UTSW 10 86,691,035 (GRCm39) missense probably damaging 1.00
K7371:Stab2 UTSW 10 86,779,153 (GRCm39) critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86,703,039 (GRCm39) missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86,697,299 (GRCm39) nonsense probably null
R0015:Stab2 UTSW 10 86,679,481 (GRCm39) missense probably benign
R0254:Stab2 UTSW 10 86,733,824 (GRCm39) missense probably benign
R0310:Stab2 UTSW 10 86,803,477 (GRCm39) splice site probably benign
R0333:Stab2 UTSW 10 86,677,491 (GRCm39) missense probably benign
R0391:Stab2 UTSW 10 86,783,008 (GRCm39) missense probably benign 0.27
R0400:Stab2 UTSW 10 86,708,474 (GRCm39) missense probably damaging 1.00
R0433:Stab2 UTSW 10 86,679,355 (GRCm39) splice site probably benign
R0440:Stab2 UTSW 10 86,785,792 (GRCm39) missense probably benign 0.23
R0743:Stab2 UTSW 10 86,723,759 (GRCm39) missense probably damaging 1.00
R0847:Stab2 UTSW 10 86,805,735 (GRCm39) missense probably benign 0.00
R0883:Stab2 UTSW 10 86,760,314 (GRCm39) splice site probably benign
R1078:Stab2 UTSW 10 86,742,997 (GRCm39) splice site probably null
R1118:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1119:Stab2 UTSW 10 86,695,619 (GRCm39) missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86,786,165 (GRCm39) missense probably damaging 0.98
R1440:Stab2 UTSW 10 86,697,231 (GRCm39) splice site probably null
R1550:Stab2 UTSW 10 86,714,790 (GRCm39) missense probably benign 0.01
R1616:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1728:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1768:Stab2 UTSW 10 86,838,872 (GRCm39) missense probably damaging 1.00
R1772:Stab2 UTSW 10 86,790,098 (GRCm39) missense probably benign 0.06
R1776:Stab2 UTSW 10 86,793,680 (GRCm39) missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1892:Stab2 UTSW 10 86,773,913 (GRCm39) missense probably damaging 0.99
R1957:Stab2 UTSW 10 86,697,334 (GRCm39) missense probably benign 0.13
R1972:Stab2 UTSW 10 86,796,180 (GRCm39) missense probably damaging 0.99
R1975:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1976:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1996:Stab2 UTSW 10 86,838,895 (GRCm39) missense probably damaging 1.00
R2085:Stab2 UTSW 10 86,790,023 (GRCm39) missense probably damaging 1.00
R2149:Stab2 UTSW 10 86,700,904 (GRCm39) nonsense probably null
R2169:Stab2 UTSW 10 86,723,726 (GRCm39) missense probably damaging 1.00
R2201:Stab2 UTSW 10 86,776,503 (GRCm39) missense probably benign 0.22
R2296:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86,805,183 (GRCm39) missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86,770,704 (GRCm39) splice site probably benign
R2696:Stab2 UTSW 10 86,697,363 (GRCm39) missense probably benign 0.45
R2883:Stab2 UTSW 10 86,803,550 (GRCm39) missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86,697,325 (GRCm39) missense probably damaging 1.00
R3711:Stab2 UTSW 10 86,702,572 (GRCm39) missense probably damaging 1.00
R3787:Stab2 UTSW 10 86,805,141 (GRCm39) missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86,785,776 (GRCm39) missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86,714,750 (GRCm39) missense probably damaging 0.97
R3979:Stab2 UTSW 10 86,699,320 (GRCm39) missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86,693,988 (GRCm39) missense probably damaging 1.00
R4088:Stab2 UTSW 10 86,758,049 (GRCm39) missense probably damaging 1.00
R4151:Stab2 UTSW 10 86,838,847 (GRCm39) missense probably benign 0.12
R4190:Stab2 UTSW 10 86,714,808 (GRCm39) missense probably damaging 0.98
R4556:Stab2 UTSW 10 86,803,543 (GRCm39) missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86,743,235 (GRCm39) nonsense probably null
R4825:Stab2 UTSW 10 86,783,011 (GRCm39) missense probably benign 0.08
R4865:Stab2 UTSW 10 86,679,364 (GRCm39) splice site probably null
R4871:Stab2 UTSW 10 86,778,099 (GRCm39) missense probably damaging 0.99
R4943:Stab2 UTSW 10 86,790,026 (GRCm39) missense probably damaging 0.99
R4981:Stab2 UTSW 10 86,796,087 (GRCm39) missense probably benign
R4994:Stab2 UTSW 10 86,785,771 (GRCm39) missense probably benign
R4999:Stab2 UTSW 10 86,773,773 (GRCm39) missense probably damaging 0.97
R5061:Stab2 UTSW 10 86,743,249 (GRCm39) missense probably damaging 1.00
R5072:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5073:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5074:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5134:Stab2 UTSW 10 86,707,674 (GRCm39) splice site probably null
R5508:Stab2 UTSW 10 86,796,143 (GRCm39) missense probably benign 0.01
R5530:Stab2 UTSW 10 86,783,026 (GRCm39) missense probably benign 0.04
R5540:Stab2 UTSW 10 86,683,989 (GRCm39) missense probably benign 0.30
R5839:Stab2 UTSW 10 86,708,555 (GRCm39) missense probably damaging 0.97
R5949:Stab2 UTSW 10 86,805,713 (GRCm39) missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86,773,906 (GRCm39) missense probably damaging 0.99
R6019:Stab2 UTSW 10 86,838,886 (GRCm39) missense probably benign 0.00
R6116:Stab2 UTSW 10 86,743,054 (GRCm39) missense probably damaging 1.00
R6131:Stab2 UTSW 10 86,719,642 (GRCm39) splice site probably null
R6209:Stab2 UTSW 10 86,758,867 (GRCm39) missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86,743,025 (GRCm39) missense probably damaging 1.00
R6433:Stab2 UTSW 10 86,737,431 (GRCm39) splice site probably null
R6787:Stab2 UTSW 10 86,754,948 (GRCm39) missense probably benign 0.07
R6841:Stab2 UTSW 10 86,778,054 (GRCm39) missense probably damaging 1.00
R6873:Stab2 UTSW 10 86,697,230 (GRCm39) critical splice donor site probably null
R7025:Stab2 UTSW 10 86,686,701 (GRCm39) missense probably damaging 1.00
R7043:Stab2 UTSW 10 86,706,110 (GRCm39) missense probably damaging 0.99
R7047:Stab2 UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
R7107:Stab2 UTSW 10 86,741,456 (GRCm39) missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86,735,705 (GRCm39) missense probably damaging 0.99
R7271:Stab2 UTSW 10 86,838,972 (GRCm39) splice site probably null
R7291:Stab2 UTSW 10 86,782,084 (GRCm39) missense probably damaging 0.96
R7336:Stab2 UTSW 10 86,805,049 (GRCm39) nonsense probably null
R7432:Stab2 UTSW 10 86,721,547 (GRCm39) missense probably damaging 0.99
R7580:Stab2 UTSW 10 86,705,028 (GRCm39) missense probably benign 0.00
R7622:Stab2 UTSW 10 86,709,766 (GRCm39) missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86,719,646 (GRCm39) critical splice donor site probably null
R7658:Stab2 UTSW 10 86,816,999 (GRCm39) missense probably benign 0.12
R7798:Stab2 UTSW 10 86,793,776 (GRCm39) missense probably damaging 0.98
R7835:Stab2 UTSW 10 86,708,483 (GRCm39) missense probably benign 0.06
R7845:Stab2 UTSW 10 86,832,758 (GRCm39) missense probably benign 0.09
R7863:Stab2 UTSW 10 86,808,745 (GRCm39) missense probably benign 0.30
R7885:Stab2 UTSW 10 86,714,776 (GRCm39) missense probably benign 0.03
R7904:Stab2 UTSW 10 86,790,056 (GRCm39) nonsense probably null
R7947:Stab2 UTSW 10 86,681,897 (GRCm39) missense probably benign 0.31
R7963:Stab2 UTSW 10 86,683,887 (GRCm39) critical splice donor site probably null
R8014:Stab2 UTSW 10 86,686,767 (GRCm39) missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86,741,403 (GRCm39) missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86,681,916 (GRCm39) missense probably benign 0.34
R8097:Stab2 UTSW 10 86,704,959 (GRCm39) missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86,709,728 (GRCm39) missense probably damaging 0.98
R8462:Stab2 UTSW 10 86,803,598 (GRCm39) missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86,776,587 (GRCm39) missense probably damaging 1.00
R8692:Stab2 UTSW 10 86,808,794 (GRCm39) missense probably damaging 0.99
R8744:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8745:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8782:Stab2 UTSW 10 86,735,685 (GRCm39) missense probably benign 0.00
R8875:Stab2 UTSW 10 86,832,728 (GRCm39) missense probably damaging 1.00
R8978:Stab2 UTSW 10 86,785,782 (GRCm39) missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9248:Stab2 UTSW 10 86,727,481 (GRCm39) missense probably damaging 0.98
R9326:Stab2 UTSW 10 86,791,010 (GRCm39) missense probably damaging 1.00
R9426:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9568:Stab2 UTSW 10 86,699,420 (GRCm39) missense probably damaging 1.00
R9627:Stab2 UTSW 10 86,793,704 (GRCm39) missense probably damaging 0.98
R9635:Stab2 UTSW 10 86,686,651 (GRCm39) nonsense probably null
R9648:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9649:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9650:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9726:Stab2 UTSW 10 86,790,095 (GRCm39) missense probably benign 0.00
R9756:Stab2 UTSW 10 86,803,553 (GRCm39) missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86,757,997 (GRCm39) missense probably benign 0.03
RF061:Stab2 UTSW 10 86,702,622 (GRCm39) critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86,758,062 (GRCm39) critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86,723,680 (GRCm39) missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86,785,778 (GRCm39) missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86,732,460 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTAATGGGTCGAAAATGTTGAC -3'
(R):5'- GAACAGATGCCTGACTATTCCATCTTC -3'

Sequencing Primer
(F):5'- ACTAGCTCTGTAGATCAGGCTGAC -3'
(R):5'- CCGGGGCTACATCATTGTAAGTAC -3'
Posted On 2016-07-22