Incidental Mutation 'R5213:Usp32'
ID403283
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission 042854-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5213 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85022259 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 941 (N941I)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect unknown
Transcript: ENSMUST00000000821
AA Change: N239I
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: N239I

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: N941I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: N941I

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,326,053 P199Q possibly damaging Het
4430402I18Rik A T 19: 28,963,564 V50E probably benign Het
Adamtsl1 C A 4: 86,385,628 H1342N possibly damaging Het
Adcy2 G T 13: 68,620,823 T1062K possibly damaging Het
Aqr T C 2: 114,113,327 N1110S probably damaging Het
Atp10a C T 7: 58,773,983 T232I probably damaging Het
Atp5f1 T A 3: 105,955,911 K70* probably null Het
Atp8b4 A C 2: 126,389,409 probably null Het
Atraid A C 5: 31,052,208 Q72P probably damaging Het
Atxn2 G T 5: 121,814,480 probably null Het
Best3 A T 10: 117,024,472 T546S probably benign Het
Brd3 T C 2: 27,463,948 K51E possibly damaging Het
Brip1 A G 11: 86,143,321 S525P possibly damaging Het
Ccdc109b A C 3: 129,916,997 F262C probably benign Het
Cenpf A G 1: 189,654,980 I1701T probably benign Het
Chrna9 A T 5: 65,971,084 K208* probably null Het
Clec2l T A 6: 38,680,192 C197S probably damaging Het
Crp A G 1: 172,698,519 H57R probably benign Het
Cyp27b1 C A 10: 127,052,095 T492N probably damaging Het
Dock4 A T 12: 40,676,742 I340F probably damaging Het
Dsg1b A T 18: 20,395,930 D241V probably damaging Het
Epg5 G T 18: 78,014,834 V1865L probably benign Het
Erap1 A G 13: 74,671,495 probably null Het
Fat2 C T 11: 55,253,832 C4072Y probably benign Het
Fat4 T A 3: 38,980,191 I2664N possibly damaging Het
Gabrp A G 11: 33,567,211 probably null Het
Glis2 G T 16: 4,614,082 probably benign Het
Gm11487 G T 4: 73,401,334 Q302K probably damaging Het
Gm17654 A G 14: 43,579,102 S15P probably damaging Het
Gm21836 A G 9: 124,493,753 V14A unknown Het
Gon7 G A 12: 102,754,121 T84I possibly damaging Het
Greb1 G T 12: 16,714,790 Y447* probably null Het
Grip2 A T 6: 91,779,831 D546E probably benign Het
Hectd1 A G 12: 51,802,533 probably null Het
Il1f6 T A 2: 24,224,474 F120L probably damaging Het
Itga4 T C 2: 79,320,576 V842A probably benign Het
Khsrp G A 17: 57,024,366 A404V probably benign Het
Map3k11 T C 19: 5,690,641 V132A probably damaging Het
Mysm1 A T 4: 94,948,377 V732E probably damaging Het
Npr2 T A 4: 43,640,673 probably null Het
Olfr101 T C 17: 37,300,051 I124V probably damaging Het
Olfr172 T C 16: 58,760,621 Y185C probably damaging Het
Olfr975 A C 9: 39,950,093 I226S probably damaging Het
Oxgr1 G T 14: 120,022,140 Y218* probably null Het
Paf1 A G 7: 28,395,972 Q161R possibly damaging Het
Pck1 A T 2: 173,156,085 K316* probably null Het
Plac8 T A 5: 100,556,505 M109L probably benign Het
Plagl2 A T 2: 153,232,319 C221S probably damaging Het
Polg T C 7: 79,454,098 D870G probably damaging Het
Polr2k T A 15: 36,174,997 M1K probably null Het
Prdm9 T C 17: 15,555,154 H276R probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Serpina3i A G 12: 104,265,655 I184V probably benign Het
Shank3 A G 15: 89,533,278 E26G possibly damaging Het
Skil T C 3: 31,117,451 S575P probably damaging Het
Slc13a1 A G 6: 24,108,159 L306P probably damaging Het
Slc20a1 G T 2: 129,200,509 W166L probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snrnp200 G T 2: 127,231,741 G1353V probably damaging Het
Sphkap A G 1: 83,280,503 I173T probably damaging Het
Stab2 A T 10: 86,907,197 F1183I probably damaging Het
Stard9 A G 2: 120,699,226 D1988G probably damaging Het
Tank T A 2: 61,649,948 I276N probably benign Het
Tcaf3 A G 6: 42,591,467 W652R probably damaging Het
Tgm2 G A 2: 158,143,060 T42I possibly damaging Het
Tnni2 G T 7: 142,443,302 probably null Het
Tns1 A G 1: 73,953,612 S9P probably damaging Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Trdv2-1 T C 14: 53,946,406 S32P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Trpm3 T G 19: 22,697,454 Y72* probably null Het
Ube2o G A 11: 116,541,459 P894S possibly damaging Het
Ubr4 C T 4: 139,402,566 R666* probably null Het
Ugt1a8 T A 1: 88,088,123 L86* probably null Het
Utrn C T 10: 12,636,760 V2322M probably damaging Het
Vmn1r184 A T 7: 26,267,711 Y294F probably damaging Het
Vmn2r108 T C 17: 20,471,493 N256S probably benign Het
Wdr7 T C 18: 63,755,126 S557P probably damaging Het
Xrra1 C A 7: 99,898,483 P293Q possibly damaging Het
Zc3h18 A G 8: 122,383,649 D79G probably damaging Het
Zfp74 A T 7: 29,935,243 Y347N probably damaging Het
Zfp740 T C 15: 102,212,647 C169R possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTTCTGGTAGACAACATTTTCA -3'
(R):5'- CCAATCAGAAGTCTTTATCAGATAGAC -3'

Sequencing Primer
(F):5'- GAAGTACATAGTGAGCCTCTGACTC -3'
(R):5'- GCTATTTGCAAGTCAGGTA -3'
Posted On2016-07-22