Incidental Mutation 'R5213:Oxgr1'
ID403295
Institutional Source Beutler Lab
Gene Symbol Oxgr1
Ensembl Gene ENSMUSG00000044819
Gene Nameoxoglutarate (alpha-ketoglutarate) receptor 1
SynonymsLOC239283, Gpr99, P2Y15, Cysltr3, Gpr80
MMRRC Submission 042854-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5213 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location120019585-120042435 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 120022140 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 218 (Y218*)
Ref Sequence ENSEMBL: ENSMUSP00000055137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058213]
Predicted Effect probably null
Transcript: ENSMUST00000058213
AA Change: Y218*
SMART Domains Protein: ENSMUSP00000055137
Gene: ENSMUSG00000044819
AA Change: Y218*

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 3.8e-35 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPCR) that belongs to the oxoglutarate receptor family within the GPCR superfamily. The encoded protein is activated by the citric acid intermediate, oxoglutarate, as well as several cysteinyl leukotrienes, including leukotrienes E4, C4 and D4, which are implicated in many inflammatory disorders. In mice, a knock-out of this gene leads to middle ear inflammation, changes in the mucosal epithelium, and an increase in fluid behind the eardrum, and is associated with hearing loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced leukotriene E4 ligand (LTE4)-induced ear edema at low and intermediate doses and abnormal acid-base balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,326,053 P199Q possibly damaging Het
4430402I18Rik A T 19: 28,963,564 V50E probably benign Het
Adamtsl1 C A 4: 86,385,628 H1342N possibly damaging Het
Adcy2 G T 13: 68,620,823 T1062K possibly damaging Het
Aqr T C 2: 114,113,327 N1110S probably damaging Het
Atp10a C T 7: 58,773,983 T232I probably damaging Het
Atp5f1 T A 3: 105,955,911 K70* probably null Het
Atp8b4 A C 2: 126,389,409 probably null Het
Atraid A C 5: 31,052,208 Q72P probably damaging Het
Atxn2 G T 5: 121,814,480 probably null Het
Best3 A T 10: 117,024,472 T546S probably benign Het
Brd3 T C 2: 27,463,948 K51E possibly damaging Het
Brip1 A G 11: 86,143,321 S525P possibly damaging Het
Ccdc109b A C 3: 129,916,997 F262C probably benign Het
Cenpf A G 1: 189,654,980 I1701T probably benign Het
Chrna9 A T 5: 65,971,084 K208* probably null Het
Clec2l T A 6: 38,680,192 C197S probably damaging Het
Crp A G 1: 172,698,519 H57R probably benign Het
Cyp27b1 C A 10: 127,052,095 T492N probably damaging Het
Dock4 A T 12: 40,676,742 I340F probably damaging Het
Dsg1b A T 18: 20,395,930 D241V probably damaging Het
Epg5 G T 18: 78,014,834 V1865L probably benign Het
Erap1 A G 13: 74,671,495 probably null Het
Fat2 C T 11: 55,253,832 C4072Y probably benign Het
Fat4 T A 3: 38,980,191 I2664N possibly damaging Het
Gabrp A G 11: 33,567,211 probably null Het
Glis2 G T 16: 4,614,082 probably benign Het
Gm11487 G T 4: 73,401,334 Q302K probably damaging Het
Gm17654 A G 14: 43,579,102 S15P probably damaging Het
Gm21836 A G 9: 124,493,753 V14A unknown Het
Gon7 G A 12: 102,754,121 T84I possibly damaging Het
Greb1 G T 12: 16,714,790 Y447* probably null Het
Grip2 A T 6: 91,779,831 D546E probably benign Het
Hectd1 A G 12: 51,802,533 probably null Het
Il1f6 T A 2: 24,224,474 F120L probably damaging Het
Itga4 T C 2: 79,320,576 V842A probably benign Het
Khsrp G A 17: 57,024,366 A404V probably benign Het
Map3k11 T C 19: 5,690,641 V132A probably damaging Het
Mysm1 A T 4: 94,948,377 V732E probably damaging Het
Npr2 T A 4: 43,640,673 probably null Het
Olfr101 T C 17: 37,300,051 I124V probably damaging Het
Olfr172 T C 16: 58,760,621 Y185C probably damaging Het
Olfr975 A C 9: 39,950,093 I226S probably damaging Het
Paf1 A G 7: 28,395,972 Q161R possibly damaging Het
Pck1 A T 2: 173,156,085 K316* probably null Het
Plac8 T A 5: 100,556,505 M109L probably benign Het
Plagl2 A T 2: 153,232,319 C221S probably damaging Het
Polg T C 7: 79,454,098 D870G probably damaging Het
Polr2k T A 15: 36,174,997 M1K probably null Het
Prdm9 T C 17: 15,555,154 H276R probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Serpina3i A G 12: 104,265,655 I184V probably benign Het
Shank3 A G 15: 89,533,278 E26G possibly damaging Het
Skil T C 3: 31,117,451 S575P probably damaging Het
Slc13a1 A G 6: 24,108,159 L306P probably damaging Het
Slc20a1 G T 2: 129,200,509 W166L probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snrnp200 G T 2: 127,231,741 G1353V probably damaging Het
Sphkap A G 1: 83,280,503 I173T probably damaging Het
Stab2 A T 10: 86,907,197 F1183I probably damaging Het
Stard9 A G 2: 120,699,226 D1988G probably damaging Het
Tank T A 2: 61,649,948 I276N probably benign Het
Tcaf3 A G 6: 42,591,467 W652R probably damaging Het
Tgm2 G A 2: 158,143,060 T42I possibly damaging Het
Tnni2 G T 7: 142,443,302 probably null Het
Tns1 A G 1: 73,953,612 S9P probably damaging Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Trdv2-1 T C 14: 53,946,406 S32P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Trpm3 T G 19: 22,697,454 Y72* probably null Het
Ube2o G A 11: 116,541,459 P894S possibly damaging Het
Ubr4 C T 4: 139,402,566 R666* probably null Het
Ugt1a8 T A 1: 88,088,123 L86* probably null Het
Usp32 T A 11: 85,022,259 N941I probably damaging Het
Utrn C T 10: 12,636,760 V2322M probably damaging Het
Vmn1r184 A T 7: 26,267,711 Y294F probably damaging Het
Vmn2r108 T C 17: 20,471,493 N256S probably benign Het
Wdr7 T C 18: 63,755,126 S557P probably damaging Het
Xrra1 C A 7: 99,898,483 P293Q possibly damaging Het
Zc3h18 A G 8: 122,383,649 D79G probably damaging Het
Zfp74 A T 7: 29,935,243 Y347N probably damaging Het
Zfp740 T C 15: 102,212,647 C169R possibly damaging Het
Other mutations in Oxgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Oxgr1 APN 14 120021930 missense probably damaging 0.97
IGL02678:Oxgr1 APN 14 120022168 missense probably damaging 1.00
IGL03387:Oxgr1 APN 14 120022787 nonsense probably null
IGL03394:Oxgr1 APN 14 120022610 missense possibly damaging 0.65
R1615:Oxgr1 UTSW 14 120022773 missense probably benign 0.25
R2919:Oxgr1 UTSW 14 120022809 start gained probably benign
R4223:Oxgr1 UTSW 14 120022613 missense probably damaging 1.00
R4409:Oxgr1 UTSW 14 120022160 missense possibly damaging 0.67
R4783:Oxgr1 UTSW 14 120022364 missense probably benign
R5226:Oxgr1 UTSW 14 120022253 missense probably damaging 1.00
R6416:Oxgr1 UTSW 14 120022448 missense probably damaging 0.99
R6491:Oxgr1 UTSW 14 120022007 missense probably benign 0.01
R6670:Oxgr1 UTSW 14 120022257 missense probably damaging 1.00
R6904:Oxgr1 UTSW 14 120022019 missense possibly damaging 0.90
R7089:Oxgr1 UTSW 14 120022202 missense probably damaging 1.00
R7819:Oxgr1 UTSW 14 120022869 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTCGATGGAGCAGCTGATTG -3'
(R):5'- AGAAAACTCGCTGGGCAGTG -3'

Sequencing Primer
(F):5'- CTGATTGAAAGCAGGCGAGATTC -3'
(R):5'- TCGCTGGGCAGTGGTAGC -3'
Posted On2016-07-22