Mutagenetix > Incidental Mutation

Incidental Mutation 'R0416:Nlrp3'

40332

Institutional Source

Beutler Lab

Gene Symbol

Nlrp3

Ensembl Gene

ENSMUSG00000032691

Gene Name

NLR family, pyrin domain containing 3

Synonyms

Cias1, cryopyrin, Pypaf1, NALP3, Mmig1

MMRRC Submission

038618-MU

Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R0416 (G1)

Quality Score

158

Status

Validated

Chromosome

Chromosomal Location

59541568-59566956 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 59555924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000098707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148]

AlphaFold

Q8R4B8

Predicted Effect

probably benign
Transcript: ENSMUST00000079476

SMART Domains

Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101148

SMART Domains

Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.2%
20x: 91.8%

Validation Efficiency

99% (74/75)

MGI Phenotype

Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	A	G	7: 119,563,556	I18V	probably benign	Het
Adamdec1	T	G	14: 68,568,712	E438A	possibly damaging	Het
Adamts17	A	G	7: 66,915,898		probably null	Het
Ankrd44	T	G	1: 54,743,339	I359L	possibly damaging	Het
Ap2s1	C	A	7: 16,747,365	N86K	probably damaging	Het
Arih1	T	A	9: 59,426,710		probably benign	Het
Astn1	T	A	1: 158,509,891	I389N	probably damaging	Het
Brca2	T	C	5: 150,569,392	S3291P	possibly damaging	Het
Cacna1d	T	C	14: 30,100,688		probably benign	Het
Ccl7	C	A	11: 82,045,866		probably benign	Het
Cd74	A	T	18: 60,811,414	Y232F	possibly damaging	Het
Cep128	A	G	12: 91,230,867		probably benign	Het
Cep89	T	A	7: 35,416,402		probably benign	Het
Cmya5	T	G	13: 93,089,856	N2908T	probably benign	Het
Coil	T	C	11: 88,981,986	L391S	possibly damaging	Het
Cpd	C	T	11: 76,785,204	V1208I	probably benign	Het
Ddx19a	T	C	8: 110,979,057	D254G	probably damaging	Het
Desi2	T	A	1: 178,256,321		probably benign	Het
Dnah11	A	T	12: 117,911,058	M4024K	probably damaging	Het
Ergic2	A	T	6: 148,183,144	L53H	probably damaging	Het
Etv2	T	C	7: 30,634,633	Y225C	probably benign	Het
F10	G	A	8: 13,055,448	A338T	probably damaging	Het
Fam228b	T	A	12: 4,762,382	D132V	probably damaging	Het
Fat2	T	A	11: 55,284,134	I1918F	possibly damaging	Het
Fbxw5	C	T	2: 25,503,239	S214F	probably damaging	Het
Glyat	G	A	19: 12,651,453	R204Q	possibly damaging	Het
Gm4825	T	C	15: 85,510,981		noncoding transcript	Het
Ino80d	G	T	1: 63,086,276	T9K	possibly damaging	Het
Lifr	A	T	15: 7,166,914	D193V	probably damaging	Het
Lrp12	G	T	15: 39,878,911		probably benign	Het
Lrp3	A	G	7: 35,202,353	V701A	probably benign	Het
Mfsd11	T	A	11: 116,865,882		probably benign	Het
Mrto4	A	T	4: 139,349,732		probably null	Het
Msi1	T	C	5: 115,430,649	F43L	possibly damaging	Het
Mthfsd	T	C	8: 121,101,237	D168G	probably damaging	Het
Myo15	T	A	11: 60,511,174	V3099E	probably damaging	Het
Myrf	T	C	19: 10,215,812		probably null	Het
Nadk	C	A	4: 155,587,799		probably benign	Het
Nav1	T	C	1: 135,471,126	K573E	possibly damaging	Het
Ndufs3	A	G	2: 90,898,388	V207A	probably damaging	Het
Nlrx1	T	G	9: 44,262,914	D330A	probably benign	Het
Olfr331	T	C	11: 58,502,396	I53M	unknown	Het
Olfr444	G	A	6: 42,955,570	C24Y	probably benign	Het
Osbpl3	C	T	6: 50,348,018	V167I	probably benign	Het
Pcnx	A	T	12: 81,974,466	I1410F	probably benign	Het
Piezo2	G	A	18: 63,024,491	R2383C	probably damaging	Het
Pip5kl1	A	T	2: 32,583,424	K358*	probably null	Het
Polg	T	C	7: 79,452,240		probably benign	Het
Prr14l	T	A	5: 32,828,717	I1145F	probably benign	Het
Psmb1	C	T	17: 15,494,519	V39I	probably benign	Het
Ptk6	T	C	2: 181,202,308	Y66C	possibly damaging	Het
Robo4	T	C	9: 37,404,766		probably benign	Het
Sdk2	A	G	11: 113,803,203	Y1801H	probably damaging	Het
Serpinb3a	C	A	1: 107,049,386	A95S	probably benign	Het
Setd1a	CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	7: 127,785,297		probably benign	Het
Sik2	A	T	9: 50,995,632	Y98N	probably damaging	Het
Slc30a1	C	T	1: 191,909,726	P495S	probably benign	Het
Smg1	A	T	7: 118,184,461		probably benign	Het
Stk3	T	A	15: 35,114,632	I45L	probably benign	Het
Tapbp	A	G	17: 33,925,418	T163A	probably damaging	Het
Tdrd5	T	C	1: 156,285,481	K410E	probably damaging	Het
Trim30b	A	T	7: 104,363,766	M152K	probably benign	Het
Trpm6	G	T	19: 18,783,025		probably benign	Het
Tsc22d1	T	C	14: 76,505,303		probably benign	Het
U2surp	A	T	9: 95,485,607	F444I	probably damaging	Het
Vmn2r95	C	T	17: 18,441,402	P470L	probably damaging	Het
Zc3h4	T	G	7: 16,420,275	Y163D	probably damaging	Het
Zfp62	A	T	11: 49,215,676	H198L	probably damaging	Het
Zmym1	A	G	4: 127,058,820	L56P	probably benign	Het

Other mutations in Nlrp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nlrp3	APN	11	59565943	missense	probably damaging	0.99
IGL00573:Nlrp3	APN	11	59565116	missense	possibly damaging	0.93
IGL01025:Nlrp3	APN	11	59551887	missense	probably benign	0.21
IGL01637:Nlrp3	APN	11	59549378	missense	probably damaging	0.99
IGL02010:Nlrp3	APN	11	59549535	missense	probably benign
IGL02334:Nlrp3	APN	11	59565083	missense	probably benign
IGL02417:Nlrp3	APN	11	59566023	unclassified	probably benign
IGL02578:Nlrp3	APN	11	59548401	missense	probably damaging	1.00
IGL02710:Nlrp3	APN	11	59565976	missense	probably damaging	0.99
IGL02816:Nlrp3	APN	11	59555782	missense	probably benign	0.03
IGL03157:Nlrp3	APN	11	59549546	missense	possibly damaging	0.80
IGL03334:Nlrp3	APN	11	59549016	missense	probably damaging	1.00
Flogiston	UTSW	11	59558448	missense	probably benign	0.00
nd1	UTSW	11	59565974	missense	probably benign	0.45
Nd14	UTSW	11	59555875	missense	possibly damaging	0.89
Nd3	UTSW	11	59565974	missense	probably benign	0.45
nd5	UTSW	11	59565879	missense	probably benign	0.01
nd6	UTSW	11	59549354	missense	probably damaging	1.00
nd7	UTSW	11	59555875	missense	possibly damaging	0.89
Nd9	UTSW	11	59549354	missense	probably damaging	1.00
Park2	UTSW	11	59565128	nonsense	probably null
Park3	UTSW	11	59565850	missense	probably benign	0.02
Park4	UTSW	11	59549531	missense	probably benign	0.19
Park5	UTSW	11	59548476	missense	probably damaging	0.99
Park6	UTSW	11	59549036	missense	probably damaging	1.00
Park7	UTSW	11	59548010	nonsense	probably null
Park8	UTSW	11	59566199	missense	probably benign	0.19
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0052:Nlrp3	UTSW	11	59565128	nonsense	probably null
R0362:Nlrp3	UTSW	11	59548797	missense	possibly damaging	0.49
R0649:Nlrp3	UTSW	11	59548542	missense	possibly damaging	0.83
R0740:Nlrp3	UTSW	11	59548256	missense	probably benign	0.01
R0863:Nlrp3	UTSW	11	59565850	missense	probably benign	0.02
R1300:Nlrp3	UTSW	11	59555768	missense	possibly damaging	0.86
R1414:Nlrp3	UTSW	11	59549531	missense	probably benign	0.19
R1622:Nlrp3	UTSW	11	59548476	missense	probably damaging	0.99
R1654:Nlrp3	UTSW	11	59543123	missense	probably benign	0.03
R1715:Nlrp3	UTSW	11	59543351	missense	probably damaging	1.00
R1754:Nlrp3	UTSW	11	59558402	missense	possibly damaging	0.80
R1837:Nlrp3	UTSW	11	59548916	missense	probably benign	0.00
R1905:Nlrp3	UTSW	11	59549036	missense	probably damaging	1.00
R2281:Nlrp3	UTSW	11	59549136	missense	possibly damaging	0.70
R4296:Nlrp3	UTSW	11	59549661	missense	possibly damaging	0.89
R4305:Nlrp3	UTSW	11	59548010	nonsense	probably null
R4540:Nlrp3	UTSW	11	59551899	missense	possibly damaging	0.83
R4591:Nlrp3	UTSW	11	59549222	missense	probably benign	0.00
R4816:Nlrp3	UTSW	11	59548301	missense	probably benign	0.32
R4913:Nlrp3	UTSW	11	59549238	missense	probably benign	0.09
R4970:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5051:Nlrp3	UTSW	11	59566199	missense	probably benign	0.19
R5112:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5185:Nlrp3	UTSW	11	59565084	missense	probably benign	0.05
R5417:Nlrp3	UTSW	11	59549063	missense	probably damaging	1.00
R5709:Nlrp3	UTSW	11	59555748	nonsense	probably null
R5869:Nlrp3	UTSW	11	59548134	missense	probably damaging	1.00
R5898:Nlrp3	UTSW	11	59546852	missense	probably benign	0.00
R5953:Nlrp3	UTSW	11	59546791	missense	probably benign
R5979:Nlrp3	UTSW	11	59548971	missense	probably benign	0.06
R6359:Nlrp3	UTSW	11	59548566	missense	probably damaging	0.97
R6723:Nlrp3	UTSW	11	59565192	missense	probably damaging	1.00
R7261:Nlrp3	UTSW	11	59548446	missense	possibly damaging	0.83
R7349:Nlrp3	UTSW	11	59548086	missense	probably damaging	1.00
R7388:Nlrp3	UTSW	11	59565066	missense	probably benign	0.00
R7715:Nlrp3	UTSW	11	59543003	splice site	probably null
R7916:Nlrp3	UTSW	11	59551863	missense	probably benign	0.00
R8222:Nlrp3	UTSW	11	59548788	missense	probably damaging	0.98
R8360:Nlrp3	UTSW	11	59549403	missense	probably benign	0.02
R8390:Nlrp3	UTSW	11	59551790	missense	possibly damaging	0.47
R8550:Nlrp3	UTSW	11	59549271	missense	probably damaging	1.00
R8738:Nlrp3	UTSW	11	59549390	missense	probably benign	0.00
R8940:Nlrp3	UTSW	11	59565044	missense	probably benign	0.26
R8990:Nlrp3	UTSW	11	59548758	missense	probably damaging	0.99
R9324:Nlrp3	UTSW	11	59543315	missense	probably damaging	1.00
R9673:Nlrp3	UTSW	11	59549322	missense	probably damaging	1.00
RF031:Nlrp3	UTSW	11	59558552	frame shift	probably null
RF040:Nlrp3	UTSW	11	59558552	frame shift	probably null
Z1088:Nlrp3	UTSW	11	59551860	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- GGACTGTCCCATCAATGCTGCTTC -3'
(R):5'- CCTCTCAAAACCGTTCTACCATGATGC -3'

Sequencing Primer
(F):5'- CATCAATGCTGCTTCGACATC -3'
(R):5'- ACCATGATGCTTAGCAGTGC -3'

Posted On

2013-05-23