Incidental Mutation 'R5214:Tbc1d19'
ID403330
Institutional Source Beutler Lab
Gene Symbol Tbc1d19
Ensembl Gene ENSMUSG00000039178
Gene NameTBC1 domain family, member 19
Synonyms
MMRRC Submission 042787-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R5214 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53809606-53903965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53849841 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 236 (L236P)
Ref Sequence ENSEMBL: ENSMUSP00000040585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037337] [ENSMUST00000201958] [ENSMUST00000202528]
Predicted Effect probably benign
Transcript: ENSMUST00000037337
AA Change: L236P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040585
Gene: ENSMUSG00000039178
AA Change: L236P

DomainStartEndE-ValueType
TBC 248 496 8.07e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201387
Predicted Effect probably benign
Transcript: ENSMUST00000201958
Predicted Effect probably benign
Transcript: ENSMUST00000202528
Meta Mutation Damage Score 0.3576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,886,493 V613A probably benign Het
1700061I17Rik A G 3: 117,067,775 noncoding transcript Het
4930449A18Rik A T 3: 59,825,884 noncoding transcript Het
Adgrl1 G A 8: 83,915,573 probably null Het
Aldh1l1 A G 6: 90,563,417 D228G probably damaging Het
Ankrd17 T C 5: 90,283,460 I822V possibly damaging Het
Atm C A 9: 53,491,027 A1382S probably benign Het
Cacna1e T A 1: 154,701,364 I96F possibly damaging Het
Ccar1 G A 10: 62,770,961 R335C probably damaging Het
Ccdc113 T C 8: 95,545,973 I236T possibly damaging Het
Ccdc14 T A 16: 34,704,855 S125T probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdon T C 9: 35,483,208 C917R probably damaging Het
Ckap2l T C 2: 129,285,469 D263G probably benign Het
Cntnap3 G T 13: 64,762,010 H760Q probably damaging Het
Dennd2d G A 3: 106,486,321 probably null Het
Dock4 A G 12: 40,704,466 I485V probably benign Het
Dspp A G 5: 104,178,498 D909G unknown Het
Eps8 A T 6: 137,527,492 M81K probably damaging Het
Fam26e A G 10: 34,092,491 S189P probably damaging Het
Fras1 T C 5: 96,769,593 S3491P probably damaging Het
Gm12569 C A 11: 51,234,848 H199Q possibly damaging Het
Gm17669 C T 18: 67,562,409 T8I possibly damaging Het
Gm5114 G T 7: 39,408,368 T609K probably benign Het
Gm973 A G 1: 59,526,721 N32S probably damaging Het
Herpud1 G T 8: 94,390,851 probably null Het
Jcad T A 18: 4,674,134 L632Q probably damaging Het
Kcnh8 T C 17: 52,898,458 L527S probably damaging Het
Klk1b11 C A 7: 43,997,842 H67N probably benign Het
Ldhb T A 6: 142,495,595 I190F probably damaging Het
Lrrc34 A T 3: 30,636,248 C168* probably null Het
Lrtm1 C T 14: 29,021,694 H40Y possibly damaging Het
Mageb3 T C 2: 121,954,838 M128V possibly damaging Het
Miga2 A G 2: 30,371,196 T90A probably benign Het
Ndrg1 G A 15: 66,959,390 T24I probably damaging Het
Nos2 T C 11: 78,955,441 L878P probably damaging Het
Olfr743 T G 14: 50,534,347 *312E probably null Het
Pcdhgb1 T A 18: 37,681,425 I323N probably damaging Het
Plec A G 15: 76,177,721 I2537T probably damaging Het
Pnpo C A 11: 96,942,469 E68D probably benign Het
Ppp6r1 C T 7: 4,643,177 R175Q probably benign Het
Prnp C T 2: 131,937,004 T192I probably damaging Het
Ptprb T C 10: 116,369,324 I2148T possibly damaging Het
Raf1 G T 6: 115,637,622 F99L possibly damaging Het
Rbks A G 5: 31,650,392 probably benign Het
Rlf T C 4: 121,150,700 D361G probably damaging Het
Rnpepl1 G T 1: 92,919,279 D608Y probably benign Het
Scaf1 G A 7: 45,003,238 probably benign Het
Sh3rf1 A T 8: 61,372,731 M587L probably damaging Het
Slc22a21 A T 11: 53,953,043 S473T probably damaging Het
Syt15 A G 14: 34,221,746 D84G possibly damaging Het
Tbx2 G T 11: 85,838,437 A549S probably benign Het
Tc2n A T 12: 101,693,202 C157* probably null Het
Tecta C T 9: 42,345,668 V1571I probably benign Het
Them4 A G 3: 94,317,511 K65R probably benign Het
Tmc5 C T 7: 118,647,932 T553M probably damaging Het
Tmem200c C T 17: 68,841,127 A235V probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tmf1 G C 6: 97,167,292 A701G possibly damaging Het
Tomm70a G A 16: 57,121,937 G26S unknown Het
Treh T C 9: 44,682,876 Y140H probably damaging Het
Ttc28 A G 5: 111,177,623 probably benign Het
Uba7 T C 9: 107,977,514 probably benign Het
Ube4a T C 9: 44,948,868 I299V probably benign Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Zfhx4 A C 3: 5,403,641 K2953T probably damaging Het
Zfp280d T A 9: 72,308,113 probably benign Het
Zscan20 G A 4: 128,588,316 R518C probably benign Het
Zw10 T C 9: 49,064,163 I296T possibly damaging Het
Other mutations in Tbc1d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Tbc1d19 APN 5 53897062 nonsense probably null
IGL01684:Tbc1d19 APN 5 53856879 missense probably benign 0.31
IGL02476:Tbc1d19 APN 5 53889413 splice site probably null
IGL02869:Tbc1d19 APN 5 53835217 missense probably benign 0.02
IGL03036:Tbc1d19 APN 5 53897047 missense probably damaging 1.00
IGL03099:Tbc1d19 APN 5 53883655 splice site probably benign
LCD18:Tbc1d19 UTSW 5 53816709 intron probably benign
R0194:Tbc1d19 UTSW 5 53860156 missense probably damaging 1.00
R1729:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1776:Tbc1d19 UTSW 5 53889311 splice site probably null
R1784:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1902:Tbc1d19 UTSW 5 53829353 missense probably benign 0.00
R3431:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R3432:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R4333:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4335:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4681:Tbc1d19 UTSW 5 53872253 missense probably damaging 1.00
R4812:Tbc1d19 UTSW 5 53809806 missense probably damaging 0.99
R5178:Tbc1d19 UTSW 5 53889325 missense possibly damaging 0.84
R6265:Tbc1d19 UTSW 5 53837924 missense probably benign 0.06
R6372:Tbc1d19 UTSW 5 53856910 missense possibly damaging 0.55
R6494:Tbc1d19 UTSW 5 53829383 missense probably benign 0.13
R6495:Tbc1d19 UTSW 5 53889213 intron probably null
R6612:Tbc1d19 UTSW 5 53809845 missense possibly damaging 0.88
R6787:Tbc1d19 UTSW 5 53835249 splice site probably null
R6965:Tbc1d19 UTSW 5 53856924 critical splice donor site probably null
R7275:Tbc1d19 UTSW 5 53872276 missense probably damaging 1.00
R7642:Tbc1d19 UTSW 5 53856918 missense probably damaging 0.98
R7655:Tbc1d19 UTSW 5 53897035
R7656:Tbc1d19 UTSW 5 53897035
X0026:Tbc1d19 UTSW 5 53835247 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCAAGACTTGAACCCAGGC -3'
(R):5'- TGCTGGAAATGACAACCGGG -3'

Sequencing Primer
(F):5'- ACTTGAACCCAGGCAGGCTAG -3'
(R):5'- CCGGGTGGAAACAAGCTACTTAC -3'
Posted On2016-07-22