Incidental Mutation 'R5214:Klk1b11'
ID403342
Institutional Source Beutler Lab
Gene Symbol Klk1b11
Ensembl Gene ENSMUSG00000044485
Gene Namekallikrein 1-related peptidase b11
SynonymsKlk11, mGK-11
MMRRC Submission 042787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5214 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43995877-43999875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43997842 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 67 (H67N)
Ref Sequence ENSEMBL: ENSMUSP00000007156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007156]
Predicted Effect probably benign
Transcript: ENSMUST00000007156
AA Change: H67N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000007156
Gene: ENSMUSG00000044485
AA Change: H67N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 6.47e-101 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206787
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,886,493 V613A probably benign Het
1700061I17Rik A G 3: 117,067,775 noncoding transcript Het
4930449A18Rik A T 3: 59,825,884 noncoding transcript Het
Adgrl1 G A 8: 83,915,573 probably null Het
Aldh1l1 A G 6: 90,563,417 D228G probably damaging Het
Ankrd17 T C 5: 90,283,460 I822V possibly damaging Het
Atm C A 9: 53,491,027 A1382S probably benign Het
Cacna1e T A 1: 154,701,364 I96F possibly damaging Het
Ccar1 G A 10: 62,770,961 R335C probably damaging Het
Ccdc113 T C 8: 95,545,973 I236T possibly damaging Het
Ccdc14 T A 16: 34,704,855 S125T probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdon T C 9: 35,483,208 C917R probably damaging Het
Ckap2l T C 2: 129,285,469 D263G probably benign Het
Cntnap3 G T 13: 64,762,010 H760Q probably damaging Het
Dennd2d G A 3: 106,486,321 probably null Het
Dock4 A G 12: 40,704,466 I485V probably benign Het
Dspp A G 5: 104,178,498 D909G unknown Het
Eps8 A T 6: 137,527,492 M81K probably damaging Het
Fam26e A G 10: 34,092,491 S189P probably damaging Het
Fras1 T C 5: 96,769,593 S3491P probably damaging Het
Gm12569 C A 11: 51,234,848 H199Q possibly damaging Het
Gm17669 C T 18: 67,562,409 T8I possibly damaging Het
Gm5114 G T 7: 39,408,368 T609K probably benign Het
Gm973 A G 1: 59,526,721 N32S probably damaging Het
Herpud1 G T 8: 94,390,851 probably null Het
Jcad T A 18: 4,674,134 L632Q probably damaging Het
Kcnh8 T C 17: 52,898,458 L527S probably damaging Het
Ldhb T A 6: 142,495,595 I190F probably damaging Het
Lrrc34 A T 3: 30,636,248 C168* probably null Het
Lrtm1 C T 14: 29,021,694 H40Y possibly damaging Het
Mageb3 T C 2: 121,954,838 M128V possibly damaging Het
Miga2 A G 2: 30,371,196 T90A probably benign Het
Ndrg1 G A 15: 66,959,390 T24I probably damaging Het
Nos2 T C 11: 78,955,441 L878P probably damaging Het
Olfr743 T G 14: 50,534,347 *312E probably null Het
Pcdhgb1 T A 18: 37,681,425 I323N probably damaging Het
Plec A G 15: 76,177,721 I2537T probably damaging Het
Pnpo C A 11: 96,942,469 E68D probably benign Het
Ppp6r1 C T 7: 4,643,177 R175Q probably benign Het
Prnp C T 2: 131,937,004 T192I probably damaging Het
Ptprb T C 10: 116,369,324 I2148T possibly damaging Het
Raf1 G T 6: 115,637,622 F99L possibly damaging Het
Rbks A G 5: 31,650,392 probably benign Het
Rlf T C 4: 121,150,700 D361G probably damaging Het
Rnpepl1 G T 1: 92,919,279 D608Y probably benign Het
Scaf1 G A 7: 45,003,238 probably benign Het
Sh3rf1 A T 8: 61,372,731 M587L probably damaging Het
Slc22a21 A T 11: 53,953,043 S473T probably damaging Het
Syt15 A G 14: 34,221,746 D84G possibly damaging Het
Tbc1d19 T C 5: 53,849,841 L236P probably benign Het
Tbx2 G T 11: 85,838,437 A549S probably benign Het
Tc2n A T 12: 101,693,202 C157* probably null Het
Tecta C T 9: 42,345,668 V1571I probably benign Het
Them4 A G 3: 94,317,511 K65R probably benign Het
Tmc5 C T 7: 118,647,932 T553M probably damaging Het
Tmem200c C T 17: 68,841,127 A235V probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tmf1 G C 6: 97,167,292 A701G possibly damaging Het
Tomm70a G A 16: 57,121,937 G26S unknown Het
Treh T C 9: 44,682,876 Y140H probably damaging Het
Ttc28 A G 5: 111,177,623 probably benign Het
Uba7 T C 9: 107,977,514 probably benign Het
Ube4a T C 9: 44,948,868 I299V probably benign Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Zfhx4 A C 3: 5,403,641 K2953T probably damaging Het
Zfp280d T A 9: 72,308,113 probably benign Het
Zscan20 G A 4: 128,588,316 R518C probably benign Het
Zw10 T C 9: 49,064,163 I296T possibly damaging Het
Other mutations in Klk1b11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Klk1b11 APN 7 43999819 missense probably damaging 1.00
IGL01501:Klk1b11 APN 7 43999834 utr 3 prime probably benign
IGL02054:Klk1b11 APN 7 43998827 missense possibly damaging 0.90
IGL02267:Klk1b11 APN 7 43999741 missense probably damaging 1.00
R0125:Klk1b11 UTSW 7 43999051 missense probably benign 0.10
R0449:Klk1b11 UTSW 7 43997792 missense probably damaging 1.00
R0708:Klk1b11 UTSW 7 43997728 missense possibly damaging 0.59
R4361:Klk1b11 UTSW 7 43995954 splice site probably null
R4452:Klk1b11 UTSW 7 43995911 missense probably damaging 0.96
R5120:Klk1b11 UTSW 7 43999022 missense probably benign 0.29
R5219:Klk1b11 UTSW 7 43999696 missense probably damaging 1.00
R6348:Klk1b11 UTSW 7 43997851 critical splice donor site probably null
R6803:Klk1b11 UTSW 7 43997837 missense probably damaging 1.00
R7065:Klk1b11 UTSW 7 43998962 missense probably benign 0.22
R7172:Klk1b11 UTSW 7 43999247 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTGCTTAACTGTGTCCATCAAG -3'
(R):5'- AGGACTCTGAACAAAATCCTTGG -3'

Sequencing Primer
(F):5'- TAACTGTGTCCATCAAGGGTTGACC -3'
(R):5'- TCCTTGGAGGATGGAGTAAAGAG -3'
Posted On2016-07-22