Mutagenetix > Incidental Mutation

Incidental Mutation 'R5214:Herpud1'

403348

Institutional Source

Beutler Lab

Gene Symbol

Herpud1

Ensembl Gene

ENSMUSG00000031770

Gene Name

homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1

Synonyms

Mifl, Herp

MMRRC Submission

042787-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R5214 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95113066-95122005 bp(+) (GRCm39)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

G to T at 95117479 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148581 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034220] [ENSMUST00000161085] [ENSMUST00000161576] [ENSMUST00000211982] [ENSMUST00000211982]

AlphaFold

Q9JJK5

Predicted Effect

probably null
Transcript: ENSMUST00000034220

SMART Domains

Protein: ENSMUSP00000034220
Gene: ENSMUSG00000031770

Domain	Start	End	E-Value	Type
UBQ	10	86	1.99e-13	SMART
low complexity region	216	242	N/A	INTRINSIC
low complexity region	273	290	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159450

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160866

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161024

Predicted Effect

probably benign
Transcript: ENSMUST00000161085

Predicted Effect

probably null
Transcript: ENSMUST00000161576

SMART Domains

Protein: ENSMUSP00000124201
Gene: ENSMUSG00000031770

Domain	Start	End	E-Value	Type
UBQ	10	87	7.55e-14	SMART
low complexity region	217	243	N/A	INTRINSIC
low complexity region	274	291	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000211982

Predicted Effect

probably null
Transcript: ENSMUST00000211982

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired glucose tolerance and decreased cerebral infarction size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061I17Rik	A	G	3: 116,861,424 (GRCm39)		noncoding transcript	Het
4930449A18Rik	A	T	3: 59,733,305 (GRCm39)		noncoding transcript	Het
Acsbg3	T	C	17: 57,193,493 (GRCm39)	V613A	probably benign	Het
Adgrl1	G	A	8: 84,642,202 (GRCm39)		probably null	Het
Aldh1l1	A	G	6: 90,540,399 (GRCm39)	D228G	probably damaging	Het
Ankrd17	T	C	5: 90,431,319 (GRCm39)	I822V	possibly damaging	Het
Atm	C	A	9: 53,402,327 (GRCm39)	A1382S	probably benign	Het
Bltp3a	G	A	17: 28,106,489 (GRCm39)	S1005N	probably benign	Het
Cacna1e	T	A	1: 154,577,110 (GRCm39)	I96F	possibly damaging	Het
Calhm5	A	G	10: 33,968,487 (GRCm39)	S189P	probably damaging	Het
Ccar1	G	A	10: 62,606,740 (GRCm39)	R335C	probably damaging	Het
Ccdc113	T	C	8: 96,272,601 (GRCm39)	I236T	possibly damaging	Het
Ccdc14	T	A	16: 34,525,225 (GRCm39)	S125T	probably benign	Het
Cdc45	C	T	16: 18,614,647 (GRCm39)	R205H	probably damaging	Het
Cdon	T	C	9: 35,394,504 (GRCm39)	C917R	probably damaging	Het
Ckap2l	T	C	2: 129,127,389 (GRCm39)	D263G	probably benign	Het
Cntnap3	G	T	13: 64,909,824 (GRCm39)	H760Q	probably damaging	Het
Dennd2d	G	A	3: 106,393,637 (GRCm39)		probably null	Het
Dock4	A	G	12: 40,754,465 (GRCm39)	I485V	probably benign	Het
Dspp	A	G	5: 104,326,364 (GRCm39)	D909G	unknown	Het
Eps8	A	T	6: 137,504,490 (GRCm39)	M81K	probably damaging	Het
Fras1	T	C	5: 96,917,452 (GRCm39)	S3491P	probably damaging	Het
Gm17669	C	T	18: 67,695,479 (GRCm39)	T8I	possibly damaging	Het
Gm5114	G	T	7: 39,057,792 (GRCm39)	T609K	probably benign	Het
Gm973	A	G	1: 59,565,880 (GRCm39)	N32S	probably damaging	Het
Jcad	T	A	18: 4,674,134 (GRCm39)	L632Q	probably damaging	Het
Kcnh8	T	C	17: 53,205,486 (GRCm39)	L527S	probably damaging	Het
Klk1b11	C	A	7: 43,647,266 (GRCm39)	H67N	probably benign	Het
Ldhb	T	A	6: 142,441,321 (GRCm39)	I190F	probably damaging	Het
Lrrc34	A	T	3: 30,690,397 (GRCm39)	C168*	probably null	Het
Lrtm1	C	T	14: 28,743,651 (GRCm39)	H40Y	possibly damaging	Het
Mageb3	T	C	2: 121,785,319 (GRCm39)	M128V	possibly damaging	Het
Miga2	A	G	2: 30,261,208 (GRCm39)	T90A	probably benign	Het
Msantd5	C	A	11: 51,125,675 (GRCm39)	H199Q	possibly damaging	Het
Ndrg1	G	A	15: 66,831,239 (GRCm39)	T24I	probably damaging	Het
Nos2	T	C	11: 78,846,267 (GRCm39)	L878P	probably damaging	Het
Or11g27	T	G	14: 50,771,804 (GRCm39)	*312E	probably null	Het
Pcdhgb1	T	A	18: 37,814,478 (GRCm39)	I323N	probably damaging	Het
Plec	A	G	15: 76,061,921 (GRCm39)	I2537T	probably damaging	Het
Pnpo	C	A	11: 96,833,295 (GRCm39)	E68D	probably benign	Het
Ppp6r1	C	T	7: 4,646,176 (GRCm39)	R175Q	probably benign	Het
Prnp	C	T	2: 131,778,924 (GRCm39)	T192I	probably damaging	Het
Ptprb	T	C	10: 116,205,229 (GRCm39)	I2148T	possibly damaging	Het
Raf1	G	T	6: 115,614,583 (GRCm39)	F99L	possibly damaging	Het
Rbks	A	G	5: 31,807,736 (GRCm39)		probably benign	Het
Rlf	T	C	4: 121,007,897 (GRCm39)	D361G	probably damaging	Het
Rnpepl1	G	T	1: 92,847,001 (GRCm39)	D608Y	probably benign	Het
Scaf1	G	A	7: 44,652,662 (GRCm39)		probably benign	Het
Sh3rf1	A	T	8: 61,825,765 (GRCm39)	M587L	probably damaging	Het
Slc22a21	A	T	11: 53,843,869 (GRCm39)	S473T	probably damaging	Het
Syt15	A	G	14: 33,943,703 (GRCm39)	D84G	possibly damaging	Het
Tbc1d19	T	C	5: 54,007,183 (GRCm39)	L236P	probably benign	Het
Tbx2	G	T	11: 85,729,263 (GRCm39)	A549S	probably benign	Het
Tc2n	A	T	12: 101,659,461 (GRCm39)	C157*	probably null	Het
Tecta	C	T	9: 42,256,964 (GRCm39)	V1571I	probably benign	Het
Them4	A	G	3: 94,224,818 (GRCm39)	K65R	probably benign	Het
Tmc5	C	T	7: 118,247,155 (GRCm39)	T553M	probably damaging	Het
Tmem200c	C	T	17: 69,148,122 (GRCm39)	A235V	probably damaging	Het
Tmem8b	G	A	4: 43,673,992 (GRCm39)	V208I	probably benign	Het
Tmf1	G	C	6: 97,144,253 (GRCm39)	A701G	possibly damaging	Het
Tomm70a	G	A	16: 56,942,300 (GRCm39)	G26S	unknown	Het
Treh	T	C	9: 44,594,173 (GRCm39)	Y140H	probably damaging	Het
Ttc28	A	G	5: 111,325,489 (GRCm39)		probably benign	Het
Uba7	T	C	9: 107,854,713 (GRCm39)		probably benign	Het
Ube4a	T	C	9: 44,860,166 (GRCm39)	I299V	probably benign	Het
Zfhx4	A	C	3: 5,468,701 (GRCm39)	K2953T	probably damaging	Het
Zfp280d	T	A	9: 72,215,395 (GRCm39)		probably benign	Het
Zscan20	G	A	4: 128,482,109 (GRCm39)	R518C	probably benign	Het
Zw10	T	C	9: 48,975,463 (GRCm39)	I296T	possibly damaging	Het

Other mutations in Herpud1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02506:Herpud1	APN	8	95,121,270 (GRCm39)	nonsense	probably null
R1667:Herpud1	UTSW	8	95,115,994 (GRCm39)	missense	probably damaging	1.00
R2015:Herpud1	UTSW	8	95,118,834 (GRCm39)	missense	probably benign	0.44
R2255:Herpud1	UTSW	8	95,121,241 (GRCm39)	missense	probably benign	0.06
R3707:Herpud1	UTSW	8	95,118,867 (GRCm39)	missense	probably damaging	1.00
R4940:Herpud1	UTSW	8	95,117,470 (GRCm39)	missense	probably benign	0.18
R4961:Herpud1	UTSW	8	95,117,454 (GRCm39)	missense	probably benign	0.00
R4981:Herpud1	UTSW	8	95,118,422 (GRCm39)	missense	probably damaging	1.00
R5499:Herpud1	UTSW	8	95,116,041 (GRCm39)	missense	probably damaging	1.00
R5835:Herpud1	UTSW	8	95,118,867 (GRCm39)	missense	probably damaging	1.00
R5985:Herpud1	UTSW	8	95,117,422 (GRCm39)	missense	probably damaging	1.00
R6702:Herpud1	UTSW	8	95,119,154 (GRCm39)	critical splice donor site	probably null
R6794:Herpud1	UTSW	8	95,121,398 (GRCm39)	splice site	probably null
R7060:Herpud1	UTSW	8	95,117,391 (GRCm39)	missense	probably benign	0.04
R7100:Herpud1	UTSW	8	95,117,475 (GRCm39)	missense	probably damaging	0.98
R7328:Herpud1	UTSW	8	95,113,248 (GRCm39)	missense	possibly damaging	0.76
R7384:Herpud1	UTSW	8	95,116,005 (GRCm39)	missense	probably damaging	0.98
R7898:Herpud1	UTSW	8	95,118,828 (GRCm39)	missense	probably benign	0.05
R8025:Herpud1	UTSW	8	95,119,149 (GRCm39)	missense	probably damaging	1.00
R8036:Herpud1	UTSW	8	95,119,014 (GRCm39)	missense	probably damaging	1.00
R8872:Herpud1	UTSW	8	95,113,213 (GRCm39)	unclassified	probably benign
R8965:Herpud1	UTSW	8	95,118,469 (GRCm39)	missense	probably damaging	1.00
R9022:Herpud1	UTSW	8	95,116,197 (GRCm39)	missense	possibly damaging	0.68
R9050:Herpud1	UTSW	8	95,117,454 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CATCAGGCCCTTTGTTCTGACG -3'
(R):5'- AAGGGGCTGTGTACTTTCGC -3'

Sequencing Primer
(F):5'- CAGGCCCTTTGTTCTGACGTTTATG -3'
(R):5'- GCTGTCCTGGAACTCGATCTG -3'

Posted On

2016-07-22