Incidental Mutation 'R0416:Sdk2'
ID40337
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0416 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113803203 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1801 (Y1801H)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
Predicted Effect probably damaging
Transcript: ENSMUST00000041627
AA Change: Y1801H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: Y1801H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156955
Meta Mutation Damage Score 0.8701 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
Curtailed UTSW 11 113851800 missense probably damaging 1.00
Trimmed UTSW 11 113856696 nonsense probably null
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
BB008:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113868083 splice site probably null
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113873201 missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113859938 missense probably benign 0.18
R8052:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113827089 missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113851713 missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113872857 missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113838716 missense probably benign
R8715:Sdk2 UTSW 11 113780902 missense not run
R8774:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113873152 nonsense probably null
RF002:Sdk2 UTSW 11 113885252 missense probably benign 0.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113839322 missense probably benign 0.41
Z1176:Sdk2 UTSW 11 113851836 missense probably damaging 0.97
Z1177:Sdk2 UTSW 11 113838659 missense probably damaging 0.99
Z1177:Sdk2 UTSW 11 113839320 missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113859956 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTAAGTAAGCTCTCCGCTTCCCAG -3'
(R):5'- ACAGACAGGACATAGCTTTCCTCCG -3'

Sequencing Primer
(F):5'- CCAGTGTCTTCTGAGCTAGACAG -3'
(R):5'- AGCCATGTTCCTGACACAGTG -3'
Posted On2013-05-23