Mutagenetix > Incidental Mutation

Incidental Mutation 'R5214:Cntnap3'

403370

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

042787-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R5214 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 64762010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 760 (H760Q)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: H760Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: H760Q

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Meta Mutation Damage Score

0.2014

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	C	17: 56,886,493	V613A	probably benign	Het
1700061I17Rik	A	G	3: 117,067,775		noncoding transcript	Het
4930449A18Rik	A	T	3: 59,825,884		noncoding transcript	Het
Adgrl1	G	A	8: 83,915,573		probably null	Het
Aldh1l1	A	G	6: 90,563,417	D228G	probably damaging	Het
Ankrd17	T	C	5: 90,283,460	I822V	possibly damaging	Het
Atm	C	A	9: 53,491,027	A1382S	probably benign	Het
Cacna1e	T	A	1: 154,701,364	I96F	possibly damaging	Het
Ccar1	G	A	10: 62,770,961	R335C	probably damaging	Het
Ccdc113	T	C	8: 95,545,973	I236T	possibly damaging	Het
Ccdc14	T	A	16: 34,704,855	S125T	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdon	T	C	9: 35,483,208	C917R	probably damaging	Het
Ckap2l	T	C	2: 129,285,469	D263G	probably benign	Het
Dennd2d	G	A	3: 106,486,321		probably null	Het
Dock4	A	G	12: 40,704,466	I485V	probably benign	Het
Dspp	A	G	5: 104,178,498	D909G	unknown	Het
Eps8	A	T	6: 137,527,492	M81K	probably damaging	Het
Fam26e	A	G	10: 34,092,491	S189P	probably damaging	Het
Fras1	T	C	5: 96,769,593	S3491P	probably damaging	Het
Gm12569	C	A	11: 51,234,848	H199Q	possibly damaging	Het
Gm17669	C	T	18: 67,562,409	T8I	possibly damaging	Het
Gm5114	G	T	7: 39,408,368	T609K	probably benign	Het
Gm973	A	G	1: 59,526,721	N32S	probably damaging	Het
Herpud1	G	T	8: 94,390,851		probably null	Het
Jcad	T	A	18: 4,674,134	L632Q	probably damaging	Het
Kcnh8	T	C	17: 52,898,458	L527S	probably damaging	Het
Klk1b11	C	A	7: 43,997,842	H67N	probably benign	Het
Ldhb	T	A	6: 142,495,595	I190F	probably damaging	Het
Lrrc34	A	T	3: 30,636,248	C168*	probably null	Het
Lrtm1	C	T	14: 29,021,694	H40Y	possibly damaging	Het
Mageb3	T	C	2: 121,954,838	M128V	possibly damaging	Het
Miga2	A	G	2: 30,371,196	T90A	probably benign	Het
Ndrg1	G	A	15: 66,959,390	T24I	probably damaging	Het
Nos2	T	C	11: 78,955,441	L878P	probably damaging	Het
Olfr743	T	G	14: 50,534,347	*312E	probably null	Het
Pcdhgb1	T	A	18: 37,681,425	I323N	probably damaging	Het
Plec	A	G	15: 76,177,721	I2537T	probably damaging	Het
Pnpo	C	A	11: 96,942,469	E68D	probably benign	Het
Ppp6r1	C	T	7: 4,643,177	R175Q	probably benign	Het
Prnp	C	T	2: 131,937,004	T192I	probably damaging	Het
Ptprb	T	C	10: 116,369,324	I2148T	possibly damaging	Het
Raf1	G	T	6: 115,637,622	F99L	possibly damaging	Het
Rbks	A	G	5: 31,650,392		probably benign	Het
Rlf	T	C	4: 121,150,700	D361G	probably damaging	Het
Rnpepl1	G	T	1: 92,919,279	D608Y	probably benign	Het
Scaf1	G	A	7: 45,003,238		probably benign	Het
Sh3rf1	A	T	8: 61,372,731	M587L	probably damaging	Het
Slc22a21	A	T	11: 53,953,043	S473T	probably damaging	Het
Syt15	A	G	14: 34,221,746	D84G	possibly damaging	Het
Tbc1d19	T	C	5: 53,849,841	L236P	probably benign	Het
Tbx2	G	T	11: 85,838,437	A549S	probably benign	Het
Tc2n	A	T	12: 101,693,202	C157*	probably null	Het
Tecta	C	T	9: 42,345,668	V1571I	probably benign	Het
Them4	A	G	3: 94,317,511	K65R	probably benign	Het
Tmc5	C	T	7: 118,647,932	T553M	probably damaging	Het
Tmem200c	C	T	17: 68,841,127	A235V	probably damaging	Het
Tmem8b	G	A	4: 43,673,992	V208I	probably benign	Het
Tmf1	G	C	6: 97,167,292	A701G	possibly damaging	Het
Tomm70a	G	A	16: 57,121,937	G26S	unknown	Het
Treh	T	C	9: 44,682,876	Y140H	probably damaging	Het
Ttc28	A	G	5: 111,177,623		probably benign	Het
Uba7	T	C	9: 107,977,514		probably benign	Het
Ube4a	T	C	9: 44,948,868	I299V	probably benign	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Zfhx4	A	C	3: 5,403,641	K2953T	probably damaging	Het
Zfp280d	T	A	9: 72,308,113		probably benign	Het
Zscan20	G	A	4: 128,588,316	R518C	probably benign	Het
Zw10	T	C	9: 49,064,163	I296T	possibly damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGATTGCCTCTACTTTTGTGACC -3'
(R):5'- TGTGTATTACTTACAGAGGGATTGC -3'

Sequencing Primer
(F):5'- GACCAAAATAAAGAGACTTGTCTGC -3'
(R):5'- CTTACAGAGGGATTGCATTTATTTTG -3'

Posted On

2016-07-22