Incidental Mutation 'R5214:Ndrg1'
ID403373
Institutional Source Beutler Lab
Gene Symbol Ndrg1
Ensembl Gene ENSMUSG00000005125
Gene NameN-myc downstream regulated gene 1
SynonymsTDD5, CMT4D, CAP43, DRG1, Tdd5, Ndr1, PROXY1, Ndrl
MMRRC Submission 042787-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5214 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location66929318-66969640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66959390 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 24 (T24I)
Ref Sequence ENSEMBL: ENSMUSP00000130150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005256] [ENSMUST00000163496] [ENSMUST00000164070] [ENSMUST00000164675] [ENSMUST00000166420] [ENSMUST00000168542] [ENSMUST00000168979] [ENSMUST00000170903] [ENSMUST00000171266] [ENSMUST00000172447]
Predicted Effect probably benign
Transcript: ENSMUST00000005256
AA Change: T24I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005256
Gene: ENSMUSG00000005125
AA Change: T24I

DomainStartEndE-ValueType
Pfam:Ndr 34 316 4.4e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163496
AA Change: T24I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130584
Gene: ENSMUSG00000005125
AA Change: T24I

DomainStartEndE-ValueType
Pfam:Ndr 34 155 1.2e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164070
AA Change: T24I

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126091
Gene: ENSMUSG00000005125
AA Change: T24I

DomainStartEndE-ValueType
Pfam:Ndr 18 53 8.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164675
AA Change: T24I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000166420
AA Change: T24I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127099
Gene: ENSMUSG00000005125
AA Change: T24I

DomainStartEndE-ValueType
Pfam:Ndr 17 132 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168542
AA Change: T24I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000168979
AA Change: T24I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126985
Gene: ENSMUSG00000005125
AA Change: T24I

DomainStartEndE-ValueType
Pfam:Ndr 34 174 6.3e-72 PFAM
Pfam:Abhydrolase_6 53 173 5.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170903
AA Change: T24I

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127302
Gene: ENSMUSG00000005125
AA Change: T24I

DomainStartEndE-ValueType
Pfam:Ndr 34 157 1.2e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171266
AA Change: T24I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171569
Predicted Effect probably damaging
Transcript: ENSMUST00000172447
AA Change: T24I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1864 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous null mice exhibit a progressive demyelinating disorder of the peripheral nerves with hindlimb weakness. Mice homozygous for a different knock-out allele exhibit decreased cellular susceptibility to gamma-irradiation and increased susceptibility to spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,886,493 V613A probably benign Het
1700061I17Rik A G 3: 117,067,775 noncoding transcript Het
4930449A18Rik A T 3: 59,825,884 noncoding transcript Het
Adgrl1 G A 8: 83,915,573 probably null Het
Aldh1l1 A G 6: 90,563,417 D228G probably damaging Het
Ankrd17 T C 5: 90,283,460 I822V possibly damaging Het
Atm C A 9: 53,491,027 A1382S probably benign Het
Cacna1e T A 1: 154,701,364 I96F possibly damaging Het
Ccar1 G A 10: 62,770,961 R335C probably damaging Het
Ccdc113 T C 8: 95,545,973 I236T possibly damaging Het
Ccdc14 T A 16: 34,704,855 S125T probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdon T C 9: 35,483,208 C917R probably damaging Het
Ckap2l T C 2: 129,285,469 D263G probably benign Het
Cntnap3 G T 13: 64,762,010 H760Q probably damaging Het
Dennd2d G A 3: 106,486,321 probably null Het
Dock4 A G 12: 40,704,466 I485V probably benign Het
Dspp A G 5: 104,178,498 D909G unknown Het
Eps8 A T 6: 137,527,492 M81K probably damaging Het
Fam26e A G 10: 34,092,491 S189P probably damaging Het
Fras1 T C 5: 96,769,593 S3491P probably damaging Het
Gm12569 C A 11: 51,234,848 H199Q possibly damaging Het
Gm17669 C T 18: 67,562,409 T8I possibly damaging Het
Gm5114 G T 7: 39,408,368 T609K probably benign Het
Gm973 A G 1: 59,526,721 N32S probably damaging Het
Herpud1 G T 8: 94,390,851 probably null Het
Jcad T A 18: 4,674,134 L632Q probably damaging Het
Kcnh8 T C 17: 52,898,458 L527S probably damaging Het
Klk1b11 C A 7: 43,997,842 H67N probably benign Het
Ldhb T A 6: 142,495,595 I190F probably damaging Het
Lrrc34 A T 3: 30,636,248 C168* probably null Het
Lrtm1 C T 14: 29,021,694 H40Y possibly damaging Het
Mageb3 T C 2: 121,954,838 M128V possibly damaging Het
Miga2 A G 2: 30,371,196 T90A probably benign Het
Nos2 T C 11: 78,955,441 L878P probably damaging Het
Olfr743 T G 14: 50,534,347 *312E probably null Het
Pcdhgb1 T A 18: 37,681,425 I323N probably damaging Het
Plec A G 15: 76,177,721 I2537T probably damaging Het
Pnpo C A 11: 96,942,469 E68D probably benign Het
Ppp6r1 C T 7: 4,643,177 R175Q probably benign Het
Prnp C T 2: 131,937,004 T192I probably damaging Het
Ptprb T C 10: 116,369,324 I2148T possibly damaging Het
Raf1 G T 6: 115,637,622 F99L possibly damaging Het
Rbks A G 5: 31,650,392 probably benign Het
Rlf T C 4: 121,150,700 D361G probably damaging Het
Rnpepl1 G T 1: 92,919,279 D608Y probably benign Het
Scaf1 G A 7: 45,003,238 probably benign Het
Sh3rf1 A T 8: 61,372,731 M587L probably damaging Het
Slc22a21 A T 11: 53,953,043 S473T probably damaging Het
Syt15 A G 14: 34,221,746 D84G possibly damaging Het
Tbc1d19 T C 5: 53,849,841 L236P probably benign Het
Tbx2 G T 11: 85,838,437 A549S probably benign Het
Tc2n A T 12: 101,693,202 C157* probably null Het
Tecta C T 9: 42,345,668 V1571I probably benign Het
Them4 A G 3: 94,317,511 K65R probably benign Het
Tmc5 C T 7: 118,647,932 T553M probably damaging Het
Tmem200c C T 17: 68,841,127 A235V probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tmf1 G C 6: 97,167,292 A701G possibly damaging Het
Tomm70a G A 16: 57,121,937 G26S unknown Het
Treh T C 9: 44,682,876 Y140H probably damaging Het
Ttc28 A G 5: 111,177,623 probably benign Het
Uba7 T C 9: 107,977,514 probably benign Het
Ube4a T C 9: 44,948,868 I299V probably benign Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Zfhx4 A C 3: 5,403,641 K2953T probably damaging Het
Zfp280d T A 9: 72,308,113 probably benign Het
Zscan20 G A 4: 128,588,316 R518C probably benign Het
Zw10 T C 9: 49,064,163 I296T possibly damaging Het
Other mutations in Ndrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Ndrg1 APN 15 66943110 missense probably damaging 1.00
IGL01419:Ndrg1 APN 15 66931051 missense probably benign 0.01
IGL02618:Ndrg1 APN 15 66940237 missense probably benign 0.03
IGL02869:Ndrg1 APN 15 66946497 missense probably benign 0.01
IGL03206:Ndrg1 APN 15 66943087 nonsense probably null
PIT4377001:Ndrg1 UTSW 15 66948439 missense probably benign
R0328:Ndrg1 UTSW 15 66943159 splice site probably benign
R1102:Ndrg1 UTSW 15 66944836 missense probably damaging 1.00
R1105:Ndrg1 UTSW 15 66940231 missense probably damaging 0.99
R1748:Ndrg1 UTSW 15 66931081 missense possibly damaging 0.55
R1875:Ndrg1 UTSW 15 66931091 missense possibly damaging 0.91
R5809:Ndrg1 UTSW 15 66930850 unclassified probably benign
R6433:Ndrg1 UTSW 15 66933872 missense probably damaging 1.00
R7104:Ndrg1 UTSW 15 66946528 missense probably damaging 1.00
R7412:Ndrg1 UTSW 15 66960533 start codon destroyed probably null 1.00
R7424:Ndrg1 UTSW 15 66944938 splice site probably null
R7667:Ndrg1 UTSW 15 66948394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGTAGAACTCAAACTAGCTTC -3'
(R):5'- CCAATTTTCTACTGGGCTGCTG -3'

Sequencing Primer
(F):5'- TCAAACTAGCTTCTTCCAGGAG -3'
(R):5'- GGCTGCTGTTCCCTGAGATAAAAC -3'
Posted On2016-07-22