Incidental Mutation 'R5214:Cdc45'
ID403375
Institutional Source Beutler Lab
Gene Symbol Cdc45
Ensembl Gene ENSMUSG00000000028
Gene Namecell division cycle 45
SynonymsCdc45l
MMRRC Submission 042787-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5214 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18780447-18811987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18795897 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 205 (R205H)
Ref Sequence ENSEMBL: ENSMUSP00000094753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000096990]
Predicted Effect probably damaging
Transcript: ENSMUST00000000028
AA Change: R251H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028
AA Change: R251H

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096990
AA Change: R205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028
AA Change: R205H

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Meta Mutation Damage Score 0.1932 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant embryos do not develop after implantation, resulting in embryonic lethality between E4.5-E5.5. Heterozygous animals appear normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,886,493 V613A probably benign Het
1700061I17Rik A G 3: 117,067,775 noncoding transcript Het
4930449A18Rik A T 3: 59,825,884 noncoding transcript Het
Adgrl1 G A 8: 83,915,573 probably null Het
Aldh1l1 A G 6: 90,563,417 D228G probably damaging Het
Ankrd17 T C 5: 90,283,460 I822V possibly damaging Het
Atm C A 9: 53,491,027 A1382S probably benign Het
Cacna1e T A 1: 154,701,364 I96F possibly damaging Het
Ccar1 G A 10: 62,770,961 R335C probably damaging Het
Ccdc113 T C 8: 95,545,973 I236T possibly damaging Het
Ccdc14 T A 16: 34,704,855 S125T probably benign Het
Cdon T C 9: 35,483,208 C917R probably damaging Het
Ckap2l T C 2: 129,285,469 D263G probably benign Het
Cntnap3 G T 13: 64,762,010 H760Q probably damaging Het
Dennd2d G A 3: 106,486,321 probably null Het
Dock4 A G 12: 40,704,466 I485V probably benign Het
Dspp A G 5: 104,178,498 D909G unknown Het
Eps8 A T 6: 137,527,492 M81K probably damaging Het
Fam26e A G 10: 34,092,491 S189P probably damaging Het
Fras1 T C 5: 96,769,593 S3491P probably damaging Het
Gm12569 C A 11: 51,234,848 H199Q possibly damaging Het
Gm17669 C T 18: 67,562,409 T8I possibly damaging Het
Gm5114 G T 7: 39,408,368 T609K probably benign Het
Gm973 A G 1: 59,526,721 N32S probably damaging Het
Herpud1 G T 8: 94,390,851 probably null Het
Jcad T A 18: 4,674,134 L632Q probably damaging Het
Kcnh8 T C 17: 52,898,458 L527S probably damaging Het
Klk1b11 C A 7: 43,997,842 H67N probably benign Het
Ldhb T A 6: 142,495,595 I190F probably damaging Het
Lrrc34 A T 3: 30,636,248 C168* probably null Het
Lrtm1 C T 14: 29,021,694 H40Y possibly damaging Het
Mageb3 T C 2: 121,954,838 M128V possibly damaging Het
Miga2 A G 2: 30,371,196 T90A probably benign Het
Ndrg1 G A 15: 66,959,390 T24I probably damaging Het
Nos2 T C 11: 78,955,441 L878P probably damaging Het
Olfr743 T G 14: 50,534,347 *312E probably null Het
Pcdhgb1 T A 18: 37,681,425 I323N probably damaging Het
Plec A G 15: 76,177,721 I2537T probably damaging Het
Pnpo C A 11: 96,942,469 E68D probably benign Het
Ppp6r1 C T 7: 4,643,177 R175Q probably benign Het
Prnp C T 2: 131,937,004 T192I probably damaging Het
Ptprb T C 10: 116,369,324 I2148T possibly damaging Het
Raf1 G T 6: 115,637,622 F99L possibly damaging Het
Rbks A G 5: 31,650,392 probably benign Het
Rlf T C 4: 121,150,700 D361G probably damaging Het
Rnpepl1 G T 1: 92,919,279 D608Y probably benign Het
Scaf1 G A 7: 45,003,238 probably benign Het
Sh3rf1 A T 8: 61,372,731 M587L probably damaging Het
Slc22a21 A T 11: 53,953,043 S473T probably damaging Het
Syt15 A G 14: 34,221,746 D84G possibly damaging Het
Tbc1d19 T C 5: 53,849,841 L236P probably benign Het
Tbx2 G T 11: 85,838,437 A549S probably benign Het
Tc2n A T 12: 101,693,202 C157* probably null Het
Tecta C T 9: 42,345,668 V1571I probably benign Het
Them4 A G 3: 94,317,511 K65R probably benign Het
Tmc5 C T 7: 118,647,932 T553M probably damaging Het
Tmem200c C T 17: 68,841,127 A235V probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tmf1 G C 6: 97,167,292 A701G possibly damaging Het
Tomm70a G A 16: 57,121,937 G26S unknown Het
Treh T C 9: 44,682,876 Y140H probably damaging Het
Ttc28 A G 5: 111,177,623 probably benign Het
Uba7 T C 9: 107,977,514 probably benign Het
Ube4a T C 9: 44,948,868 I299V probably benign Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Zfhx4 A C 3: 5,403,641 K2953T probably damaging Het
Zfp280d T A 9: 72,308,113 probably benign Het
Zscan20 G A 4: 128,588,316 R518C probably benign Het
Zw10 T C 9: 49,064,163 I296T possibly damaging Het
Other mutations in Cdc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Cdc45 APN 16 18811561 missense probably damaging 1.00
IGL01677:Cdc45 APN 16 18787000 missense probably benign 0.02
IGL02079:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02080:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02105:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02106:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02237:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02238:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02239:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02371:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02441:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02442:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02465:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02466:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02468:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02469:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02470:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02471:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02472:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02473:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02489:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02490:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02491:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02492:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02511:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02558:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02559:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02560:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02561:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02562:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02566:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02567:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02576:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02583:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02589:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02626:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02627:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02628:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02629:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02687:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02688:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02689:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02720:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02724:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02731:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02738:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02991:Cdc45 UTSW 16 18798729 missense probably benign 0.06
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0458:Cdc45 UTSW 16 18781972 splice site probably benign
R1398:Cdc45 UTSW 16 18781971 splice site probably benign
R1413:Cdc45 UTSW 16 18808741 missense possibly damaging 0.63
R1792:Cdc45 UTSW 16 18807340 missense probably benign 0.01
R2919:Cdc45 UTSW 16 18808793 missense probably benign 0.00
R3956:Cdc45 UTSW 16 18805430 missense probably benign 0.00
R4079:Cdc45 UTSW 16 18811360 missense probably damaging 1.00
R4825:Cdc45 UTSW 16 18784863 missense probably damaging 0.98
R5028:Cdc45 UTSW 16 18795180 missense probably benign 0.43
R5215:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5309:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5311:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5312:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5352:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5353:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5354:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5355:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5356:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5424:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5426:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5655:Cdc45 UTSW 16 18807279 critical splice donor site probably null
R6174:Cdc45 UTSW 16 18794704 intron probably null
R6796:Cdc45 UTSW 16 18784857 missense probably damaging 1.00
R7910:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
R7991:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACATGGGTGGTTCTATCAC -3'
(R):5'- ATTGACTGTGTGGGCTAGACAC -3'

Sequencing Primer
(F):5'- GGTTCTATCACCATAGTAACGAAAC -3'
(R):5'- TATCTCAGTACCTAAAGATGGGGC -3'
Posted On2016-07-22